ID: 1062718669

View in Genome Browser
Species Human (GRCh38)
Location 9:138023592-138023614
Sequence CCGCGCGCGCCGCTCGCCCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 147}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062718669_1062718691 26 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718691 9:138023641-138023663 CCGGGAGGCGGAGAGCGGGGAGG 0: 1
1: 0
2: 3
3: 80
4: 757
1062718669_1062718678 8 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718678 9:138023623-138023645 CGGCCCCCGAGCGGGGCCCCGGG 0: 1
1: 0
2: 2
3: 32
4: 323
1062718669_1062718685 21 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718685 9:138023636-138023658 GGGCCCCGGGAGGCGGAGAGCGG 0: 1
1: 0
2: 6
3: 77
4: 701
1062718669_1062718684 14 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718684 9:138023629-138023651 CCGAGCGGGGCCCCGGGAGGCGG 0: 1
1: 0
2: 6
3: 38
4: 401
1062718669_1062718687 23 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718687 9:138023638-138023660 GCCCCGGGAGGCGGAGAGCGGGG 0: 1
1: 0
2: 3
3: 44
4: 570
1062718669_1062718680 11 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718680 9:138023626-138023648 CCCCCGAGCGGGGCCCCGGGAGG 0: 1
1: 0
2: 4
3: 26
4: 223
1062718669_1062718673 -1 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718673 9:138023614-138023636 GCACCGCGGCGGCCCCCGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 122
1062718669_1062718675 1 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718675 9:138023616-138023638 ACCGCGGCGGCCCCCGAGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 101
1062718669_1062718686 22 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718686 9:138023637-138023659 GGCCCCGGGAGGCGGAGAGCGGG 0: 1
1: 0
2: 5
3: 61
4: 494
1062718669_1062718677 7 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718677 9:138023622-138023644 GCGGCCCCCGAGCGGGGCCCCGG 0: 1
1: 1
2: 2
3: 34
4: 397
1062718669_1062718674 0 Left 1062718669 9:138023592-138023614 CCAAGGGCGAGCGGCGCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1062718674 9:138023615-138023637 CACCGCGGCGGCCCCCGAGCGGG 0: 1
1: 0
2: 0
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062718669 Original CRISPR CCGCGCGCGCCGCTCGCCCT TGG (reversed) Exonic
901084638 1:6603014-6603036 CCCCGCGCGGCGCCCGCCCCCGG + Intronic
901242975 1:7705352-7705374 ACGCGCGCCCCTCACGCCCTCGG - Intronic
901659088 1:10787505-10787527 CCGCCCGCCCCCCTCGCCCCCGG - Intronic
904039438 1:27575658-27575680 CCGGCCGCGCGGCCCGCCCTCGG + Intronic
904620613 1:31772914-31772936 CCGGGCCCGCCGCCAGCCCTGGG + Intergenic
907407113 1:54260458-54260480 CCGTGTGCGCCACACGCCCTTGG - Intronic
908293125 1:62688001-62688023 CCGCGCCCGCCGCTGAGCCTCGG - Intronic
912670480 1:111619965-111619987 CCGCGCCCCCCGCTCCCTCTGGG - Intronic
914824571 1:151132143-151132165 CAGCGCGCGCGGCCCGCCCGGGG + Exonic
916890232 1:169106502-169106524 CCGAGCGCTCCTCTAGCCCTTGG - Exonic
917929818 1:179815493-179815515 CCACGCTCGCCGCCCTCCCTTGG + Exonic
918282838 1:183023177-183023199 CCTCGCGCGCCCCTCCCCCCGGG + Intergenic
920002331 1:202808253-202808275 CCGCGCCCGGCGCTGCCCCTCGG - Exonic
920394124 1:205631637-205631659 CCGCGCGCGGGGCTCCCCCTCGG + Exonic
922306977 1:224352737-224352759 CCGCGGGCCCCGCCGGCCCTGGG - Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
1063393574 10:5666209-5666231 CACCGAGCGCCGCGCGCCCTGGG - Intronic
1064274203 10:13891779-13891801 CCGCCCCCGCCGCGGGCCCTCGG + Intronic
1065022216 10:21509980-21510002 CTGCGCCCCCCGCTCGCCCCTGG + Intergenic
1065687853 10:28303304-28303326 CCGCCCGGTTCGCTCGCCCTTGG + Intronic
1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG + Intronic
1067462123 10:46465798-46465820 CCGGGCGCGCTGCCTGCCCTTGG - Exonic
1067625072 10:47918800-47918822 CCGGGCGCGCTGCCTGCCCTTGG + Intergenic
1069438548 10:68407336-68407358 CCCGGGGCGCCGCTCCCCCTGGG - Intergenic
1070570702 10:77637905-77637927 GCCCGCGCCCCGCTCGCCCCGGG + Intronic
1073441445 10:103555181-103555203 ACGCGCACGCCGCCCGCCCGCGG - Intronic
1074819599 10:117168338-117168360 CCGAGCGCGCACCACGCCCTCGG + Intergenic
1077063337 11:627072-627094 CCGCGCGCCCCGCGCCCCCCAGG - Exonic
1077361765 11:2143985-2144007 CTGCCCGCGCCGCCCGCGCTCGG - Intronic
1080283588 11:30585364-30585386 CCGCGCGCGCCGCTCTCGCTCGG - Intronic
1081807740 11:45899630-45899652 CCCCGCTCGCCCCTCCCCCTCGG + Intronic
1081938065 11:46918384-46918406 CCGCCCGCGCCGCTCGCCCGGGG + Exonic
1083849024 11:65354766-65354788 CCGTGCGCGCCGCCCGCGCCGGG - Exonic
1087138111 11:94740504-94740526 CCGCCGCCGCCGCGCGCCCTCGG + Intronic
1089966161 11:122656247-122656269 CCGCGCGCGCGGCCGGCCCTCGG + Intronic
1093435318 12:19129658-19129680 CCGCGCGCGCCCTACCCCCTCGG - Intergenic
1101131711 12:101697548-101697570 CCGCGCTCGCGGGTCACCCTCGG - Intronic
1101910551 12:108857617-108857639 CCGGGCCCGCCCCTCCCCCTCGG + Intergenic
1103509729 12:121466607-121466629 GCGCGCCCGCCGCCCGCCGTGGG - Intronic
1103547536 12:121712795-121712817 GCGCGCTCGCCGACCGCCCTCGG - Exonic
1104977738 12:132559860-132559882 CCGCGCCCGCCGCCGGCCCGGGG - Intronic
1107133347 13:36919730-36919752 CCGCCCGCGCCGCGGGCCCCGGG - Intronic
1112344119 13:98576602-98576624 CCGCGCGCCCGGCTCGGCCGGGG - Intronic
1112693056 13:101917174-101917196 CCGCCGGCGCCGCCCGCTCTCGG + Intronic
1113724599 13:112588592-112588614 CCGCGCGGGCCGGTCCCCCCCGG + Intergenic
1118019328 14:61695332-61695354 CCGCCTGCGTCGCTCGCCATTGG + Intergenic
1124014286 15:25862941-25862963 CCGCCGTCGCCGCTCGCCCTTGG + Exonic
1124500756 15:30225162-30225184 CCTCGTGCGCCGCCCGCCCCCGG + Intergenic
1124742814 15:32313505-32313527 CCTCGTGCGCCGCCCGCCCCCGG - Intergenic
1128743177 15:70097021-70097043 CCGCGCCCGCCGCCCGGCCCCGG - Exonic
1131144307 15:90001609-90001631 CCGCGCGGGACACTCACCCTGGG - Exonic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1132398267 15:101489642-101489664 CCGCGCGCGCCGCCTGCGCCCGG - Exonic
1132419422 15:101652563-101652585 CCACGCGCCCCTCACGCCCTTGG + Intergenic
1132719686 16:1309616-1309638 CCGCGCGCCCCGCCCGCGCCAGG + Intronic
1133013075 16:2925537-2925559 CCGCGCGCGCTGATTGGCCTGGG - Intronic
1133038094 16:3046019-3046041 CTGCGCGCGGGGCTCGGCCTGGG - Intergenic
1134615858 16:15650551-15650573 TCGCGCTGGCCCCTCGCCCTTGG + Intronic
1136566469 16:31073529-31073551 CCGCCCGCGCTGCTCGCGCTGGG + Intronic
1138178718 16:54928827-54928849 CCGCGCGCGCCGCCCGCCGGGGG - Intergenic
1138591064 16:58000175-58000197 CCGCCCTCGGGGCTCGCCCTCGG - Intronic
1138660710 16:58515559-58515581 CCGCGCCCGCCACTCACCCGTGG - Exonic
1139754581 16:69132367-69132389 CCGCGCGCCCCGCCCGGCCCCGG + Intronic
1139779537 16:69339424-69339446 CCGCTCGCGCCACTGGGCCTCGG + Exonic
1141828582 16:86497397-86497419 CCGCGCGCGGGGCTCGGCCGAGG + Intergenic
1142055901 16:87995829-87995851 CCGGGCGCGCTGCTTCCCCTTGG - Intronic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1143521159 17:7445164-7445186 CTGGGGGCGCCGCTCGCCCCAGG + Exonic
1144339173 17:14298409-14298431 CCACGCGCGGCGGTCGCTCTCGG - Intergenic
1146208216 17:30922472-30922494 CCAGGCGCGCCCCACGCCCTCGG + Intronic
1147612876 17:41811984-41812006 GCGGGCGCGCCGCCCGCCCGGGG - Exonic
1147684055 17:42276420-42276442 GCGCGCGCGCCGCTCACGCGCGG + Intronic
1148262043 17:46192904-46192926 CCCCGCCCGCCGCTGGCCCTCGG - Intronic
1151802018 17:76384416-76384438 GCGCCCCCGCCGCTCGTCCTAGG - Intronic
1152245550 17:79183049-79183071 CCTCGCGCCGCGCGCGCCCTGGG + Intronic
1152728687 17:81959792-81959814 CCGCGCGCGACGGTCGCACGGGG + Intronic
1160164039 18:76495082-76495104 CCGCGCCCACCGCCCGCCCGCGG + Intronic
1160204613 18:76822632-76822654 CCGCGCGCCTTGCTCTCCCTGGG - Intronic
1160583220 18:79899443-79899465 GCGCGCGCCCAGCTCGCGCTCGG - Exonic
1160725407 19:616072-616094 CCTCGTGCGCCGCCCGCCCCCGG + Exonic
1160834185 19:1116882-1116904 CCGCGTGCGCGCCTCGCCCGTGG + Exonic
1160948066 19:1652501-1652523 CCGCGCACGCCGCTGCCCCAGGG - Intronic
1163473611 19:17512172-17512194 CCGCGCCCACCGGTTGCCCTCGG + Intronic
1165448294 19:35868727-35868749 CTGCGCGCGCAGCCCGCCATCGG + Exonic
1167587639 19:50384012-50384034 CCCCGCCCGCCTCTCGCCCGGGG - Intergenic
926077304 2:9951661-9951683 CCGCGCGGGCTGCGCGCACTGGG - Intergenic
926422961 2:12716940-12716962 GCGCGCGCCTCGCTCGCGCTCGG - Exonic
927811871 2:26184992-26185014 CTGCCCGCGCCGCGCGCCCCCGG + Exonic
927937962 2:27086105-27086127 CCGGGTGCGGCGCTCGCCCAGGG - Exonic
928432834 2:31234600-31234622 TCGCGGCCGCCGCTCGCCCCCGG - Exonic
934754627 2:96816555-96816577 CAGCGCGCGCCACTCGCCCGCGG - Exonic
938970047 2:136423661-136423683 CCGCGGGCTGCGCACGCCCTTGG - Intergenic
940775217 2:157876760-157876782 CCGCCTGCCCCGCGCGCCCTCGG - Intronic
942313980 2:174682222-174682244 CCGGGCGGCCCGCTCGCCCCAGG - Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
946431189 2:219628038-219628060 CCGCGCGCGCCGATCACCTGGGG - Exonic
947435457 2:230068518-230068540 CCGCGCGCGCCGCGGGCCTGGGG - Intronic
1170999220 20:21396680-21396702 CAGCACGCCCCGCGCGCCCTCGG + Intronic
1172284637 20:33732128-33732150 CCGCGGCCGCTGCGCGCCCTAGG - Intronic
1173488452 20:43458521-43458543 CCCCGCGCGCTCCGCGCCCTTGG + Intronic
1174475759 20:50794877-50794899 CAGCGCGCGCCGCTCGCCACTGG + Exonic
1175198882 20:57265180-57265202 CCGCGCGCTCCGAGCGCCTTGGG - Intronic
1178314939 21:31559558-31559580 GCGCGCGCGCGGCTCGGCATCGG + Intronic
1178992182 21:37366150-37366172 CCGCGCTCGCCTCTCTCCCCGGG - Intronic
1179890005 21:44330659-44330681 CCGCACACGCAGCTCCCCCTGGG + Exonic
1180649987 22:17369605-17369627 CCCCGCCCGGCGCCCGCCCTCGG + Exonic
1180699616 22:17774275-17774297 CAGGGCCCGCCGCCCGCCCTGGG - Intronic
1183432455 22:37774013-37774035 CTGAGCGCGCCCCTCGCACTGGG + Exonic
1183452959 22:37906581-37906603 CCGCGCCGCCCGCTCGCCCGGGG - Intronic
1184207659 22:43015169-43015191 CCGCCCCCGCCGCTCCCGCTGGG + Intergenic
954076882 3:48188096-48188118 CCGGCCGCGCCGCTTGCCCGCGG - Exonic
961028891 3:123585051-123585073 CGGCCCGAGCCGCTCGCGCTAGG - Exonic
962714539 3:138115311-138115333 CCGCGCGGCCCGCTCACCGTGGG + Exonic
967994039 3:195153360-195153382 CCGCGTGCCCCGCTGGCTCTGGG - Intronic
968965376 4:3766658-3766680 TCGCCCGCGCCGCTCGCATTGGG - Exonic
984667840 4:182448263-182448285 CCGCGCTCGCCCCTGGGCCTCGG - Intronic
984953226 4:185021324-185021346 GCGCGCGCACCGCACGCCCGCGG + Intergenic
984999739 4:185471434-185471456 CCGCCCGCCCAGCGCGCCCTCGG - Intronic
985512908 5:322109-322131 CCGTGCGGGCCGCGCTCCCTGGG + Intronic
985537444 5:473165-473187 CCCCGCCCCCGGCTCGCCCTCGG + Intergenic
998166768 5:139848654-139848676 GCCCGCGCGCCTCTCGCCCGTGG - Exonic
999768436 5:154757022-154757044 GCCCGCGGGCCGCTCGGCCTCGG + Intronic
1001506435 5:172283900-172283922 CCGCGCGCCGCCCTCGCCTTCGG + Exonic
1001843550 5:174901618-174901640 CAGCCGGCGCCGCTGGCCCTGGG + Intergenic
1006665092 6:35688280-35688302 CCCGGCGCTCGGCTCGCCCTGGG + Intronic
1007465688 6:42049586-42049608 CCGCGGGCACCCCACGCCCTGGG + Intronic
1010379069 6:75205953-75205975 CCGCGCCCGCCTCTCCTCCTGGG - Exonic
1011603455 6:89080916-89080938 CAGCGGGAGCCGCTCGTCCTGGG + Exonic
1015799400 6:137044908-137044930 CTCCGCGAGTCGCTCGCCCTTGG - Exonic
1017174988 6:151494205-151494227 CCGCGCGCGGGGGTGGCCCTGGG + Intronic
1017737733 6:157380318-157380340 CCGCGCCCGCAGCTCCTCCTGGG + Intergenic
1018400303 6:163414553-163414575 CCCCGCCCGCCGCCCGCCCCCGG + Intronic
1019381617 7:727107-727129 GCCCGCGCGCCGCCCGCCCGAGG + Exonic
1019711460 7:2519965-2519987 CAGCGCGCGCCGGCCGCGCTCGG - Exonic
1027773976 7:82443189-82443211 CGGTGCGCGCCGCTCGCCGCTGG - Intronic
1028135511 7:87219857-87219879 CGCCGCCCGCCGCTCGCCCCCGG + Intronic
1028622186 7:92836653-92836675 CCGCCCGCGCCGCTCGCTGGGGG + Intergenic
1028796407 7:94908117-94908139 CCGCCCGCGGCGCTCCCGCTCGG + Intronic
1028856144 7:95596368-95596390 CCGGACGCGCCGCGCCCCCTCGG - Exonic
1029414736 7:100435831-100435853 CCGCCCGCCCCCCTCACCCTCGG + Exonic
1033406493 7:141074505-141074527 CCGGGCGAGCCGCTCGCGCCTGG + Exonic
1037855276 8:22367196-22367218 CGGCCCGCCCCGCTCGCCCCGGG - Intergenic
1038575491 8:28701071-28701093 CCGCGCACGGCGCCCGTCCTTGG + Intronic
1041108000 8:54459657-54459679 CCGCGCCCGCCGCCCGCCCCGGG - Exonic
1041109396 8:54470485-54470507 CCGCGCGCGCCGCCCGCCAAGGG - Intergenic
1042020592 8:64369457-64369479 CGGCGCGCTCCGCCCGCCCGCGG - Intergenic
1043388226 8:79768224-79768246 CCGCACGCGCCGCGGGCCGTGGG + Intergenic
1049643608 8:143726515-143726537 CTCCATGCGCCGCTCGCCCTTGG + Exonic
1061128045 9:128689212-128689234 CTGCGCCCGCCCCTCGCCGTAGG + Intronic
1062491640 9:136807871-136807893 CCGCGCGCGCCGCGCCCCCGCGG + Intergenic
1062574611 9:137200371-137200393 CCGCCCGCGCCGCCCGCCCCGGG - Exonic
1062718669 9:138023592-138023614 CCGCGCGCGCCGCTCGCCCTTGG - Exonic
1185605442 X:1365805-1365827 CCGCGCACCCCGCTCACCCGGGG - Intronic
1185605514 X:1366017-1366039 CCGCGCACCCCGCTCACCCGGGG - Intronic
1185605671 X:1366494-1366516 CCGCGCACCCCGCTCACCCGGGG - Intronic
1185605728 X:1366663-1366685 CCGCGCACCCCGCTCACCCGGGG - Intronic
1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG + Intergenic
1189010723 X:37043564-37043586 GCGCCCGCGCTGCCCGCCCTGGG - Intergenic
1189035680 X:37491991-37492013 GCGCCCGCGCTGCCCGCCCTGGG + Intronic
1189281205 X:39821221-39821243 CCCCGGGCGCCGCTCGGGCTAGG + Intergenic
1192495940 X:71616716-71616738 CCGCAGGCGCCGCTGGCCCCTGG + Exonic
1196936133 X:120733005-120733027 CCGAGCCCGCCGCTCGGCCGAGG - Intergenic
1197734893 X:129843406-129843428 CCGCGCCCGCGGCTCGGCCCCGG - Intronic
1199724701 X:150568750-150568772 CCGCGCGACCCGCTGGCCCAAGG - Intronic