ID: 1062721123

View in Genome Browser
Species Human (GRCh38)
Location 9:138044696-138044718
Sequence CAGGTGGACGGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062721114_1062721123 -2 Left 1062721114 9:138044675-138044697 CCGGCCAGAGCAGGGGCTGGGCA 0: 1
1: 0
2: 7
3: 60
4: 529
Right 1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG No data
1062721107_1062721123 14 Left 1062721107 9:138044659-138044681 CCACACAAGAGCTTGCCCGGCCA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG No data
1062721116_1062721123 -6 Left 1062721116 9:138044679-138044701 CCAGAGCAGGGGCTGGGCAGGTG 0: 1
1: 0
2: 11
3: 85
4: 671
Right 1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG No data
1062721113_1062721123 -1 Left 1062721113 9:138044674-138044696 CCCGGCCAGAGCAGGGGCTGGGC 0: 1
1: 1
2: 14
3: 119
4: 715
Right 1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062721123 Original CRISPR CAGGTGGACGGGAGGGCAGA GGG Intronic
No off target data available for this crispr