ID: 1062722030

View in Genome Browser
Species Human (GRCh38)
Location 9:138049615-138049637
Sequence CCGCCCGGTCCCAGAGCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062722030_1062722038 21 Left 1062722030 9:138049615-138049637 CCGGTGGCTCTGGGACCGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1062722038 9:138049659-138049681 CGTTTGCCTCCCAGGGTCCTTGG No data
1062722030_1062722036 14 Left 1062722030 9:138049615-138049637 CCGGTGGCTCTGGGACCGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1062722036 9:138049652-138049674 TGTCCAGCGTTTGCCTCCCAGGG No data
1062722030_1062722035 13 Left 1062722030 9:138049615-138049637 CCGGTGGCTCTGGGACCGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1062722035 9:138049651-138049673 GTGTCCAGCGTTTGCCTCCCAGG No data
1062722030_1062722039 24 Left 1062722030 9:138049615-138049637 CCGGTGGCTCTGGGACCGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1062722039 9:138049662-138049684 TTGCCTCCCAGGGTCCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062722030 Original CRISPR CCGCCCGGTCCCAGAGCCAC CGG (reversed) Intronic
900083215 1:874628-874650 CCGACCCCTCCTAGAGCCACTGG - Intergenic
900131784 1:1090303-1090325 CAGACCGGCCCCTGAGCCACTGG - Intronic
900187977 1:1341887-1341909 CTGCCAGCTCCCAGACCCACAGG - Intronic
901051740 1:6428910-6428932 CCTCCTGGCCCCAGAGCCCCTGG + Intronic
901608245 1:10475704-10475726 CCTCCCGGCCGCAGAGGCACAGG - Intronic
902807956 1:18872540-18872562 TCCCCAGGTCCCTGAGCCACTGG + Exonic
904215384 1:28914747-28914769 GAGCCCGGCCCCGGAGCCACCGG + Intronic
904847550 1:33431223-33431245 CCGCCCGTTGCCATGGCCACCGG - Intergenic
905877350 1:41441062-41441084 CCGCCCAGTCTCAGATCCATAGG + Intergenic
910622590 1:89273304-89273326 CCGCCCGGTGCAAGATCCACTGG - Intergenic
914048202 1:144107813-144107835 CCGCCTGAGCACAGAGCCACAGG + Intergenic
914130982 1:144857635-144857657 CCGCCTGAGCACAGAGCCACAGG - Intergenic
914191103 1:145411917-145411939 CCGCACGGCCCCAGAGTCAGGGG + Intergenic
914589037 1:149089920-149089942 CCGCACGGCCCCAGAGTCAGGGG + Intronic
914778375 1:150759850-150759872 GAGCCCAGTCCCAGAGGCACTGG + Intronic
915535697 1:156534101-156534123 CTGCCAGGTGCCAGAGCCAGAGG - Exonic
918388719 1:184036915-184036937 CCGCCCGATCCGCCAGCCACCGG + Intronic
920851660 1:209632175-209632197 CTGCCAGGTCTGAGAGCCACTGG - Intronic
922215448 1:223516307-223516329 AGGCCAAGTCCCAGAGCCACGGG + Intergenic
922727005 1:227927320-227927342 CCCCAAGGTCCCAGAGGCACGGG + Intronic
923692324 1:236206810-236206832 CCTCACCGTCTCAGAGCCACAGG - Intronic
1063115118 10:3067473-3067495 CCGCCCGGCCCCAGCGCCAATGG - Intronic
1063154118 10:3362794-3362816 TCTCCCCCTCCCAGAGCCACTGG + Intergenic
1063266439 10:4456365-4456387 CAGCCCGGAGGCAGAGCCACTGG + Intergenic
1063504036 10:6580238-6580260 CCGCGCAGTCCCAGCGCCACCGG - Exonic
1065107247 10:22402531-22402553 CCGTCAAGTGCCAGAGCCACAGG + Intronic
1065588228 10:27240818-27240840 CAGCCCCGCCCCAGAGTCACCGG + Intronic
1067101634 10:43338648-43338670 GCACTCGGTCCCACAGCCACTGG - Intergenic
1067477203 10:46575036-46575058 CAGCCAGGTCTCAGAGCCCCCGG + Intergenic
1067617536 10:47766745-47766767 CAGCCAGGTCTCAGAGCCCCCGG - Intergenic
1069890303 10:71648410-71648432 CCACGTGGTCCCAGACCCACAGG - Intronic
1070814187 10:79312840-79312862 CCGCCCCGCACCAGAGCCACGGG + Exonic
1072312768 10:94172184-94172206 CCTCCCTATCCCAGGGCCACAGG - Intronic
1074109768 10:110414612-110414634 CCCCCCGGTACCAGAACAACAGG - Intergenic
1074826346 10:117217774-117217796 CAGCACGGTGCCAGAGCGACGGG - Intergenic
1075514236 10:123096556-123096578 CCCGGCAGTCCCAGAGCCACTGG + Intergenic
1076379561 10:130015770-130015792 CCGCCTGGCCCCAGGCCCACTGG - Intergenic
1076612809 10:131737009-131737031 CCCCCCGGCCCCCGAGCCTCGGG - Intergenic
1076696923 10:132251489-132251511 CCCCCCCTTCCCAGGGCCACAGG - Intronic
1076834942 10:133016345-133016367 CAGCCCAGGCCCAGAGCCACCGG + Intergenic
1077195824 11:1279460-1279482 CCGCCAGGCCCCAGAGCTCCTGG - Intronic
1080638570 11:34144752-34144774 CCTCCCCTGCCCAGAGCCACTGG + Intronic
1082854743 11:57796499-57796521 CCGTCTGGTCCCATAGCGACTGG - Exonic
1083758409 11:64803230-64803252 CCCCGCGGCCTCAGAGCCACGGG - Exonic
1084275530 11:68049341-68049363 CCCCGCGGTCACAGGGCCACTGG + Intronic
1084331799 11:68434773-68434795 CCTCGCTCTCCCAGAGCCACCGG + Intronic
1085475202 11:76784597-76784619 CCGCCCGGCTCCAGAGGCGCGGG - Intronic
1089398879 11:118153073-118153095 CCTCGCGGTCCCGGAGCCCCGGG + Intergenic
1091222139 11:133935942-133935964 CCCCCAGCTCCAAGAGCCACGGG + Intronic
1093172418 12:15875004-15875026 GCGCCCGGTGCGAGATCCACTGG + Intronic
1096263159 12:50105272-50105294 CCGCACTGTCCCACAGCCAAGGG + Intronic
1098209496 12:68148772-68148794 CCTCCCCCTGCCAGAGCCACAGG + Intergenic
1100240542 12:92706798-92706820 CTGCCTTGTCCCACAGCCACGGG - Exonic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103541406 12:121669064-121669086 CCCCTAGGTCCCAGAGCCCCGGG + Intronic
1103694074 12:122799897-122799919 CAGCTAGGACCCAGAGCCACAGG - Intronic
1104307377 12:127621729-127621751 CACACCAGTCCCAGAGCCACGGG - Intergenic
1106077646 13:26475209-26475231 CTGCCCACTCCCGGAGCCACTGG - Intergenic
1109510628 13:63367670-63367692 CAGACCAGCCCCAGAGCCACGGG - Intergenic
1110857756 13:80315098-80315120 CAGCCCTGTCCAAGAACCACTGG + Intergenic
1113532404 13:111037803-111037825 CCCTCCAGTCCCAGAGCCCCTGG - Intergenic
1117842086 14:59870552-59870574 CCCCCCGGTGCCTGAGCCACTGG + Exonic
1118318764 14:64741394-64741416 CCGCGGGCTCCCAAAGCCACTGG - Exonic
1122939380 14:104974416-104974438 CCACCCCGTCCCAGATGCACTGG + Intronic
1124373666 15:29117175-29117197 CCGCCCGGGCCCAGAGGAGCTGG + Exonic
1124387780 15:29224733-29224755 CGGCCCGGTGCCGGATCCACTGG - Intronic
1129267239 15:74400278-74400300 CCTCCCTGTCTCAGAGCCTCAGG + Intergenic
1129733375 15:77944481-77944503 CCACCCGTTTCCGGAGCCACTGG + Intergenic
1131047794 15:89327029-89327051 ACTCCAGGTCCCAGAGCCAGGGG + Exonic
1131791899 15:95974115-95974137 CTGCCTGGTTCCAGAGCCTCAGG + Intergenic
1132498184 16:273660-273682 CTCCACGGTCCCAGGGCCACCGG + Intronic
1132709991 16:1262257-1262279 CTGCCCGGGCCCAGAGACTCGGG - Intergenic
1132839501 16:1972211-1972233 CCGCACGGCCCCAGAGCTCCGGG - Intronic
1132875593 16:2135620-2135642 CCGCCAGCGCCCCGAGCCACAGG + Exonic
1132934630 16:2474363-2474385 CGGCCCTGTCCCAGGGGCACTGG + Intergenic
1133236166 16:4388388-4388410 CTGCCGGGTCTCAGAGCCTCAGG - Intronic
1134519393 16:14911733-14911755 CCGCCAGCGCCCCGAGCCACAGG - Intronic
1134554540 16:15154495-15154517 CCGCCAGCGCCCCGAGCCACAGG + Intergenic
1134707063 16:16310388-16310410 CCGCCAGCGCCCCGAGCCACAGG - Intergenic
1134960477 16:18401736-18401758 CCGCCAGCGCCCCGAGCCACAGG + Intergenic
1136537684 16:30910153-30910175 GCGCCAGGCCCCAGAGACACAGG - Intergenic
1141618189 16:85221932-85221954 CCTCCCGGTCCCCGCCCCACAGG + Intergenic
1143321184 17:6070317-6070339 CCGCCGGGTCCTAGAGGCGCCGG - Intronic
1147586800 17:41657570-41657592 CCACCCGGCCTCAGAGCCAGGGG + Intergenic
1147742115 17:42675587-42675609 CCACCCGGGCACCGAGCCACTGG + Intronic
1147982538 17:44283448-44283470 CAGTCAGGACCCAGAGCCACAGG + Intergenic
1148100584 17:45088179-45088201 CGGCCAGGTCCCAGGCCCACTGG + Intronic
1148733372 17:49851234-49851256 CCGCCCGGTCCCCGCGGCCCCGG + Intergenic
1148786079 17:50146874-50146896 CAGCCCTGTCCCAGAGCCTGGGG - Intronic
1148895862 17:50838734-50838756 ACGCCAGGTCTCAGAGCCACAGG - Intronic
1148912119 17:50948414-50948436 CCGCCTGGGCCCAGTGCCAAGGG - Intergenic
1149754047 17:59172941-59172963 CCTCCCGGTGCGAGATCCACTGG + Intronic
1151370709 17:73644775-73644797 GCGCCCGGCCCCAGCGCCCCCGG - Intergenic
1151370896 17:73645417-73645439 CCTGCGGGTCCCAGAGCCGCTGG - Intergenic
1152124974 17:78441231-78441253 CCGCCCTGGCCCAGAGCCTCAGG - Intronic
1152223629 17:79082610-79082632 CTGCCCGTTCCCAGAGCCCCAGG + Intronic
1152570858 17:81120692-81120714 GGGCCTGGTCCCAGAGCCTCCGG - Exonic
1152609100 17:81306947-81306969 CCGCCCAGTGCCAGAGCCGGGGG + Intergenic
1152795070 17:82302653-82302675 CAGCCTGGTCCCAGAGCCCGGGG + Intergenic
1155095888 18:22556427-22556449 CCTCCTGGACCCAGAGCCAAAGG + Intergenic
1160204558 18:76822443-76822465 CGGCCCGGTCCGAGCGCCGCCGG - Intergenic
1160910410 19:1471354-1471376 CCGCCTTGTCCCAGAGCCTCGGG - Exonic
1161169733 19:2806832-2806854 ACGCCCTGTCCCAGGGCCAAAGG - Intronic
1161646482 19:5456313-5456335 AGGCCTGGGCCCAGAGCCACAGG - Exonic
1161946391 19:7440073-7440095 GCGCCGGGTCCCGGAGCCCCGGG + Exonic
1162033583 19:7927543-7927565 CCACCCAGTCCCAGAGCTTCAGG + Intronic
1162913901 19:13864390-13864412 CCAGCAGGTCCCAGAGCCACAGG - Intronic
1163488895 19:17605711-17605733 CCTCCCGGTACCAGAGCCCCGGG + Exonic
1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG + Intergenic
1165382435 19:35490569-35490591 CCTCCCCCTCCCAGAGCCCCGGG - Intronic
1165751796 19:38264741-38264763 CCGCCAGGTGCCAAAGCCCCCGG - Exonic
1166060804 19:40324164-40324186 CCTGCCTGTCCCAGAGCTACTGG - Intronic
1166222798 19:41376584-41376606 CCGCCTGCTCCCAGACCCCCGGG + Exonic
1166303780 19:41926576-41926598 CCACCCAGGGCCAGAGCCACGGG - Intronic
1166768591 19:45266697-45266719 CCACAGGGTCCCAGAGTCACAGG + Intronic
1167125376 19:47545268-47545290 CCGGCAGGTTCCGGAGCCACTGG + Exonic
1167281241 19:48570150-48570172 CCGGCGGTTCCCACAGCCACAGG - Intronic
1167367680 19:49063678-49063700 CCACCCTTTCCCAGAACCACAGG - Intronic
1167520173 19:49950092-49950114 CCGCAGGCTCCCAGAGCCTCAGG + Exonic
1202687654 1_KI270712v1_random:60708-60730 CCGCCTGAGCACAGAGCCACAGG + Intergenic
926205259 2:10830997-10831019 CCTCACTGTCCCTGAGCCACAGG + Intronic
926320786 2:11746993-11747015 CCGCGCAGTCCCAGAACCGCGGG + Intronic
926630284 2:15129488-15129510 CTGCCCTGTCCCAAAGCTACAGG + Intergenic
927518853 2:23687440-23687462 ACGCCCTGCCCCACAGCCACAGG + Intronic
928103287 2:28452038-28452060 CCGCCTGCTCCCACGGCCACAGG - Intergenic
928371674 2:30744497-30744519 TCGCCCATACCCAGAGCCACGGG - Intronic
933847447 2:86337380-86337402 GCGCCCGGTCCCAGTGGCTCGGG - Intronic
936104723 2:109614432-109614454 CAGCGCGGTCCCATAGCGACGGG - Exonic
938115205 2:128597716-128597738 CCGGCAGGCCCCAGAGCCTCTGG - Intergenic
944191683 2:197010294-197010316 CCCCACGGTCACCGAGCCACAGG + Intronic
947375892 2:229494582-229494604 CAGCCCTGCCCCAGAGACACTGG + Intronic
947535194 2:230935646-230935668 CAGCCCAGTCCCAGAGCCCAGGG - Intronic
948644116 2:239393084-239393106 GCGGCCCGTCTCAGAGCCACAGG + Intronic
948650351 2:239439891-239439913 CCGCCATGCCCCAGTGCCACAGG - Intergenic
948739403 2:240033141-240033163 CAGCCTGGCCCCAGAGGCACAGG - Intergenic
948796646 2:240406290-240406312 CAGCTTGGTCCCAGAGCCCCAGG - Intergenic
949032082 2:241802079-241802101 CCACCCAGACCCACAGCCACAGG - Intronic
1169224199 20:3846359-3846381 CCGCCCGCTCCCACTCCCACAGG + Intergenic
1171355566 20:24543231-24543253 CGCCCCAGTACCAGAGCCACCGG + Exonic
1171475838 20:25407938-25407960 CCGCCCCGCCCCAGAGCCCAGGG - Intronic
1172013180 20:31858273-31858295 CCCCCCAGTCCCAGAGGCACAGG + Intronic
1175265463 20:57700614-57700636 CATCCAGATCCCAGAGCCACTGG + Intronic
1175439677 20:58981620-58981642 CCGCCCCGCGCCAGAGCCTCCGG - Intronic
1176126565 20:63478118-63478140 CCTCGAGGTCCCAGAGCTACAGG - Intergenic
1176230387 20:64029732-64029754 CCGCCGGGTCACAGACTCACTGG + Intronic
1176232419 20:64039098-64039120 CCGCCCCGTCCAGGTGCCACAGG - Intronic
1181350246 22:22250126-22250148 CCGCCTGAGCACAGAGCCACAGG + Intergenic
1181668489 22:24414320-24414342 CACCCCTGCCCCAGAGCCACAGG - Intronic
1182421956 22:30252883-30252905 CAGCCATGTCCCAGGGCCACAGG - Intergenic
1182516571 22:30862295-30862317 CCACCTGGTCCCACAGCCCCTGG + Intronic
1183501249 22:38181060-38181082 CCTCCCTGTCCCACACCCACAGG + Intronic
1184101902 22:42345161-42345183 CAGCCAGGTCTCAGGGCCACCGG + Intergenic
952383058 3:32818997-32819019 CCGGCCGGTCCCACAGCGAGGGG + Intronic
961345625 3:126261394-126261416 CCACCCTGTCTCAGAGCCAGGGG + Intergenic
961536823 3:127575714-127575736 CCCGCCTGTCCCAGAGCCGCCGG + Intronic
962177254 3:133167650-133167672 CTGCCCGGGGCCAGTGCCACCGG + Intronic
968704949 4:2073400-2073422 CAGCTCTGTTCCAGAGCCACTGG + Intronic
968956270 4:3721390-3721412 CCCCCAGGTCCCAGCCCCACGGG - Intergenic
969254034 4:5990523-5990545 CCGCCTCCTCCCAAAGCCACAGG - Intergenic
969436623 4:7192693-7192715 CCGCCCGAGCCCCGAGCCCCGGG + Exonic
969570267 4:8004235-8004257 CCGCCCGGTCCCACAGCGAGAGG + Intronic
969702199 4:8773806-8773828 CCGCCCGGCCCCCGTGCCTCTGG + Intergenic
982669112 4:158298962-158298984 CCGCCTGGTCCCCTAGCCACCGG + Intergenic
983448952 4:167887592-167887614 CGAGCTGGTCCCAGAGCCACAGG + Intergenic
984803722 4:183735806-183735828 CCGCCCAGTCCCGGAGCGAGCGG - Intergenic
985512873 5:321958-321980 CCGCCCCGTCCCGGGGCCGCCGG - Intronic
985528737 5:421398-421420 CGGCCCGGACTCAGAGGCACAGG + Intronic
985538059 5:475462-475484 CCCCCAGGTCCCAGTGCCCCTGG + Intronic
985705065 5:1395674-1395696 CGGCCAGGACCCACAGCCACGGG + Intronic
986993347 5:13578892-13578914 CAGCCCGGTGCCGGATCCACTGG + Intergenic
987693638 5:21300251-21300273 ATGCCAGGTCCCAGAGACACTGG - Intergenic
990008568 5:50969374-50969396 CCTCCCGGCCACACAGCCACAGG + Intergenic
990869545 5:60415837-60415859 CCGCCCGGTGCGGGACCCACTGG + Intronic
991300760 5:65126900-65126922 CCACCGGGTCTCAGAGCTACAGG + Intergenic
991746630 5:69749295-69749317 ATGCCAGGTCCCAGAGACACTGG + Intergenic
991751075 5:69805947-69805969 ATGCCAGGTCCCAGAGACACTGG - Intergenic
991798232 5:70329238-70329260 ATGCCAGGTCCCAGAGACACTGG + Intergenic
991826008 5:70624607-70624629 ATGCCAGGTCCCAGAGACACTGG + Intergenic
991830362 5:70680842-70680864 ATGCCAGGTCCCAGAGACACTGG - Intergenic
991890568 5:71328554-71328576 ATGCCAGGTCCCAGAGACACTGG + Intergenic
1000889254 5:166784480-166784502 CAGCCTGGTCCCGGATCCACTGG - Intergenic
1002297250 5:178238544-178238566 CCACCCAGCCCCAAAGCCACCGG - Exonic
1002416808 5:179125027-179125049 ACGCCCGGCCCGAGAGCCGCCGG - Exonic
1004752942 6:18582652-18582674 CCCCATGGTCCCAGAGTCACTGG - Intergenic
1005557271 6:26999687-26999709 ATGCCAGGTCCCAGAGACACTGG + Intergenic
1006522655 6:34581039-34581061 CAGCTGGGTCCCAGAACCACTGG - Intergenic
1006790444 6:36697864-36697886 CCACCAGGTCCCAGAGCCCAGGG + Exonic
1008943764 6:57074664-57074686 CAGCCCGGTCCCCTAGCCGCAGG + Intergenic
1009471480 6:64031545-64031567 CGGCCCGGTGCAAGATCCACTGG + Intronic
1011449007 6:87473122-87473144 CAGCCAGGCCCCAGAGGCACTGG - Intronic
1015868649 6:137753735-137753757 ATGCCAGGCCCCAGAGCCACAGG + Intergenic
1019149480 6:169994485-169994507 CCGTCAGGACCCTGAGCCACAGG + Intergenic
1020116236 7:5478013-5478035 GGGTCCGGACCCAGAGCCACAGG - Intronic
1023605760 7:41929321-41929343 CCACCGGAGCCCAGAGCCACAGG - Intergenic
1026858533 7:73770235-73770257 CCGCCCGCCCACAAAGCCACAGG - Exonic
1029737282 7:102471911-102471933 ACACTCGGTCCCAGAGGCACTGG + Intronic
1031918595 7:127585361-127585383 CCGCCCGGTCCCAGGCCCGGAGG + Exonic
1036645800 8:10611022-10611044 CGGCCAGGACCCAGAGCCAGAGG - Exonic
1036695072 8:10968829-10968851 CTCCCCAGTCCCAGAGCCCCTGG - Intronic
1037990883 8:23320434-23320456 CTGGCGGGTTCCAGAGCCACTGG + Intronic
1040791079 8:51231024-51231046 CAGCCCGGTGCGAGATCCACTGG + Intergenic
1041259663 8:56009932-56009954 CCGCCCTGTCCCAGGGCTACAGG + Exonic
1041275870 8:56157179-56157201 CCGGGCTGTCCCAGAGCCGCAGG + Intergenic
1049252969 8:141598991-141599013 CCGCCCAGCCCCTGTGCCACAGG + Intergenic
1049298085 8:141854556-141854578 CCTCCCTGTTCCAAAGCCACGGG - Intergenic
1049639264 8:143707158-143707180 CCGGCCGCTCCCAGAGCGGCGGG + Exonic
1049656956 8:143803268-143803290 CCGCCCAGACCCAGAGGCACAGG + Intronic
1049850260 8:144826948-144826970 CCGCGGGGTCGCAGAGCCTCCGG - Intergenic
1053533130 9:38901260-38901282 CCGCCTTGTTCCAGCGCCACAGG - Intergenic
1054205356 9:62125689-62125711 CCGCCTTGTTCCAGCGCCACAGG - Intergenic
1054633005 9:67462681-67462703 CCGCCTTGTTCCAGCGCCACAGG + Intergenic
1057147061 9:92765256-92765278 CCGCCGGCTGCCAGAGGCACAGG - Intergenic
1061328627 9:129878929-129878951 CTGCCGGGCCCCGGAGCCACAGG - Intronic
1062396943 9:136356393-136356415 TCGCCAGCTCCCAGAGCCGCCGG + Exonic
1062618062 9:137407056-137407078 CCGCCCGTTCACAGAGGCACCGG + Intronic
1062722030 9:138049615-138049637 CCGCCCGGTCCCAGAGCCACCGG - Intronic
1186180486 X:6968433-6968455 CCCCCCTGCCCCAGACCCACAGG - Intergenic
1186293281 X:8122030-8122052 CGGCCCAGTGCCAGATCCACTGG + Intergenic
1187572526 X:20519320-20519342 CAGCCCTGCCCCAGAGCTACTGG - Intergenic
1192342782 X:70277825-70277847 GCACCTGGTCCCAAAGCCACAGG + Intronic
1200150653 X:153949864-153949886 CTCCCAGGTCCCAGAGCCCCAGG + Intronic