ID: 1062722547

View in Genome Browser
Species Human (GRCh38)
Location 9:138051929-138051951
Sequence CCTTGCCCTGCAGGTGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 316}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062722547_1062722553 6 Left 1062722547 9:138051929-138051951 CCTGTGGCACCTGCAGGGCAAGG 0: 1
1: 0
2: 3
3: 54
4: 316
Right 1062722553 9:138051958-138051980 TGCTCCTGGGTCCTCCACCCTGG 0: 1
1: 0
2: 2
3: 33
4: 354
1062722547_1062722561 30 Left 1062722547 9:138051929-138051951 CCTGTGGCACCTGCAGGGCAAGG 0: 1
1: 0
2: 3
3: 54
4: 316
Right 1062722561 9:138051982-138052004 GTCTGAGACAAAATGCACAGGGG 0: 1
1: 0
2: 0
3: 21
4: 316
1062722547_1062722551 -7 Left 1062722547 9:138051929-138051951 CCTGTGGCACCTGCAGGGCAAGG 0: 1
1: 0
2: 3
3: 54
4: 316
Right 1062722551 9:138051945-138051967 GGCAAGGCCTCTCTGCTCCTGGG 0: 1
1: 0
2: 2
3: 32
4: 296
1062722547_1062722550 -8 Left 1062722547 9:138051929-138051951 CCTGTGGCACCTGCAGGGCAAGG 0: 1
1: 0
2: 3
3: 54
4: 316
Right 1062722550 9:138051944-138051966 GGGCAAGGCCTCTCTGCTCCTGG 0: 1
1: 0
2: 3
3: 32
4: 320
1062722547_1062722559 28 Left 1062722547 9:138051929-138051951 CCTGTGGCACCTGCAGGGCAAGG 0: 1
1: 0
2: 3
3: 54
4: 316
Right 1062722559 9:138051980-138052002 GAGTCTGAGACAAAATGCACAGG 0: 1
1: 0
2: 1
3: 13
4: 157
1062722547_1062722560 29 Left 1062722547 9:138051929-138051951 CCTGTGGCACCTGCAGGGCAAGG 0: 1
1: 0
2: 3
3: 54
4: 316
Right 1062722560 9:138051981-138052003 AGTCTGAGACAAAATGCACAGGG 0: 1
1: 0
2: 2
3: 15
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062722547 Original CRISPR CCTTGCCCTGCAGGTGCCAC AGG (reversed) Intronic
900175709 1:1290543-1290565 CCAGGCCCTGCAGGTGAGACGGG + Exonic
901456929 1:9368370-9368392 CCTTGCCCTGCAGTTTCCAGGGG + Exonic
902264053 1:15248417-15248439 CCTTGCCCTGCAAGTACCCCGGG + Intronic
903235386 1:21947134-21947156 CCTGGCCATGCAGAGGCCACAGG - Intergenic
903265525 1:22155891-22155913 CCTTCCCCTGCAGGTGAGAAGGG + Intergenic
904551743 1:31324759-31324781 CATGGGCCTGCAGGTGCCCCTGG + Intronic
905953239 1:41970894-41970916 CCTTGCCCTACAGGTTTCAGAGG + Intronic
906739975 1:48173241-48173263 CCTGGCATTCCAGGTGCCACTGG + Intergenic
907309796 1:53532682-53532704 CCCTGCCCTGCATGGGCCAGAGG - Intronic
908121695 1:60991843-60991865 GCGTGCCCTGCAGGTGCGAGGGG - Intronic
911541383 1:99162236-99162258 CCTGGCGTTCCAGGTGCCACTGG + Intergenic
912737795 1:112165568-112165590 CCTGGCCCTGCAAGAGCCCCAGG + Intergenic
914899931 1:151706451-151706473 CTCAGCCCTGCAGGTGCCACTGG - Intronic
915405814 1:155658933-155658955 CCTTGGCCTTCAGGTAACACTGG + Intergenic
916043637 1:160982098-160982120 CCGTGCCTTGAAGATGCCACGGG + Intergenic
916717615 1:167458371-167458393 CCCTGCCCTGCATGTGACTCAGG + Intronic
920388590 1:205584860-205584882 TCATGCCCTGCAGGAGGCACAGG - Exonic
921097766 1:211901764-211901786 CATTGGCCTGCAGGTGCTCCTGG + Intergenic
921098724 1:211910228-211910250 CCTTGCCCTTCAGGGGCCCCTGG + Intergenic
921540304 1:216406027-216406049 CCTTCCCCTACTGCTGCCACAGG - Intronic
924797295 1:247301414-247301436 GCCAGCCCTGCAGGGGCCACTGG + Intronic
924874657 1:248089284-248089306 CCTTGCCCAGAGGGTGGCACAGG - Intronic
1062896685 10:1108749-1108771 CAGGGCCCTGCAGGTTCCACGGG - Intronic
1063144884 10:3288120-3288142 CCTTGTCCTGCCGGTGGCCCTGG + Intergenic
1064193473 10:13227166-13227188 CATTGCCCTGCAGGTGCACCTGG - Intronic
1066317791 10:34265841-34265863 CTTTGGCCTGCAGCTCCCACAGG - Intronic
1069824575 10:71247219-71247241 CCCTGCCCTGAAGGTGCCTATGG + Intronic
1069994388 10:72333618-72333640 CTTTGCCTTATAGGTGCCACAGG - Exonic
1070354723 10:75628795-75628817 GCTGGCCATGCATGTGCCACTGG + Intronic
1070934127 10:80280437-80280459 CCTTCCCCTGCACATGCCAGTGG - Intronic
1071500687 10:86202167-86202189 CCGTGCCCTGGAGATGCCCCTGG + Intronic
1071526335 10:86361865-86361887 CCCTGTACTCCAGGTGCCACAGG + Intronic
1072285184 10:93907700-93907722 CCTCGCCCTTCAGCTGCCAAAGG - Intronic
1073854772 10:107661713-107661735 TCTTGCCCTGCAACTGCCTCAGG - Intergenic
1075158927 10:120005715-120005737 AATTGTCCTGCAGGTGCCACAGG - Intergenic
1076297776 10:129400612-129400634 CTTTGCCCTGCACCTCCCACAGG + Intergenic
1076462796 10:130657792-130657814 CCGTTCACTGCAGGAGCCACGGG - Intergenic
1076712714 10:132347509-132347531 CCTTCCCATGCAGGCCCCACTGG - Intronic
1076847451 10:133076245-133076267 CCTTGCCCTGAGGGTGCCCAAGG - Intronic
1076992400 11:282317-282339 CCTTGCCCTGGAGGAGCCGAGGG - Intronic
1077047002 11:551118-551140 CCTCCCCCTGCAGGTGCCCAGGG + Exonic
1080653106 11:34238231-34238253 CCTAGCCATGCAGATGCCAGGGG - Intronic
1081467543 11:43336299-43336321 CCTTGCCTTGAAGCTGCAACTGG - Intronic
1081782996 11:45726449-45726471 CCTTGTCCTGCCGGTGCCCGGGG + Intergenic
1081810061 11:45909538-45909560 GCTTGCCCTGCAGGCTCCAGAGG - Intergenic
1081990823 11:47336691-47336713 CCTTGGCCTGCCCTTGCCACAGG + Intronic
1082005270 11:47415695-47415717 CCTTGCCCTGCTGGGACCCCGGG + Exonic
1083298584 11:61728351-61728373 CCCTCCGCTGCAGGGGCCACAGG - Intronic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1083975822 11:66119070-66119092 CCTTGTCCATCTGGTGCCACTGG - Intronic
1084310171 11:68312392-68312414 CCCTGCCCTGGAGGTGCCTCCGG - Intergenic
1084564039 11:69919523-69919545 CCTTTCCCTGCAGCTCACACAGG + Intergenic
1085052868 11:73388787-73388809 CCTTCCCCTGCTGATGCCTCGGG + Intronic
1087803522 11:102530634-102530656 CCTGGCCCTGCCGCTGCCTCAGG - Exonic
1089256708 11:117198055-117198077 GCTTTTCCTGCAGGCGCCACTGG + Intergenic
1089346659 11:117795785-117795807 CCCTGCCCTGCCGGTGCTCCAGG - Intronic
1091563368 12:1630541-1630563 CCTTGCCCAGCAGCTGCACCGGG - Intronic
1091985658 12:4909005-4909027 CCTTGCCCTGCGAGTGCGGCTGG - Intergenic
1092028244 12:5261285-5261307 TCTTGCCCTCCAGCTGCCTCTGG - Intergenic
1092332126 12:7594331-7594353 ACTGGCATTGCAGGTGCCACTGG - Intergenic
1095976112 12:47942155-47942177 GCCTGACCTGCAGGGGCCACGGG + Intronic
1095983855 12:47987103-47987125 CCTGGCCCTCAAGGTGCAACTGG - Exonic
1098089426 12:66885310-66885332 CCCTGCTCTGCAGGTGCCAAGGG - Intergenic
1099938837 12:89160761-89160783 CCTTTCCCACCAGGTGCCAGAGG - Intergenic
1101277554 12:103219034-103219056 CCTGGCATTCCAGGTGCCACTGG - Intergenic
1101747936 12:107558363-107558385 TCTGGCCCTGCAGGTGCTCCAGG + Intronic
1102441850 12:112969659-112969681 CCTTGGCCAGCAGGTCCCAGCGG - Exonic
1104023810 12:125011776-125011798 ATTTGCCCTCCAGGTGACACAGG - Intronic
1104042081 12:125137084-125137106 CCCAGCCCTGCAGGTCCAACTGG + Intronic
1104491751 12:129200435-129200457 CTCTTCCCTGCAGGTGACACAGG + Intronic
1104827113 12:131719997-131720019 CCTGGGCCTGGAGATGCCACAGG - Intronic
1104943020 12:132403768-132403790 CCTTGCCCTTGAGTTGCCAGCGG + Intergenic
1106791116 13:33155411-33155433 CCTTGCCTTGCAGATGCTAATGG - Intronic
1107430123 13:40332823-40332845 CCTGGACCTGCAGTTGCCATGGG + Intergenic
1110968641 13:81733079-81733101 GCTAGCATTGCAGGTGCCACTGG + Intergenic
1111097041 13:83530375-83530397 CCTAGCCATGCTGATGCCACTGG - Intergenic
1111403077 13:87766807-87766829 CCTTGTCCTGATGATGCCACTGG - Intergenic
1112595809 13:100805954-100805976 CCTTCCCCTGCAGGTTTCAAAGG - Intergenic
1113646437 13:111999817-111999839 CCCTGGCCTGCAGGTGGCACAGG + Intergenic
1113835765 13:113327677-113327699 CCTTGTTCTGCACCTGCCACTGG + Intronic
1114083106 14:19218638-19218660 CCCTGCTCTGCAGGTCTCACAGG - Intergenic
1114253223 14:20979493-20979515 CCTTAACCTGCAGGTACCAACGG - Intergenic
1118385999 14:65256044-65256066 CACAGCCCTGCAGGTGGCACTGG + Intergenic
1118635911 14:67748537-67748559 CCTTGTCCAGCAGGTGCAGCAGG - Exonic
1119786664 14:77319688-77319710 CCTTGCCATCCAAGTCCCACAGG - Intronic
1120401522 14:84038580-84038602 ACATGCCCTGCCTGTGCCACAGG - Intergenic
1121713326 14:96055177-96055199 CCCTGCTCTGCAGGTCCCATGGG + Intronic
1121921073 14:97882290-97882312 CTTTGCCCTGGAGGTGACAGAGG - Intergenic
1122230205 14:100303252-100303274 ACTTGCCCAGGATGTGCCACTGG + Intronic
1122786890 14:104168016-104168038 CCTGGGCCTGGGGGTGCCACAGG + Intronic
1122838573 14:104443369-104443391 CCCTGCTCTGCAGCTGCCACTGG - Intergenic
1202894729 14_GL000194v1_random:406-428 CCCTGCCCTGCAGGTCTCACAGG - Intergenic
1124100115 15:26685099-26685121 CCTTTCCCTGCAGGTCCCATGGG + Intronic
1124557853 15:30744691-30744713 ACTTGTCCAGCAGGTGCCGCGGG - Intronic
1124673383 15:31660965-31660987 ACTTGTCCAGCAGGTGCCGCGGG + Intronic
1125540408 15:40466716-40466738 CTTTGCCCTGCAGTAGCAACTGG + Exonic
1125965616 15:43873428-43873450 GCTTTTCCTGCTGGTGCCACTGG - Exonic
1126111767 15:45179405-45179427 CCCTGCCCTCCAGGAGCCACAGG - Intronic
1127298939 15:57633991-57634013 CCTTGCTTTGCTGGTGCCCCAGG + Intronic
1127739943 15:61893297-61893319 CCATGCCCTGCAGGAGGCAGTGG + Intronic
1132546310 16:534941-534963 CCCTGCCCCGCAGGTGACACAGG - Intronic
1132576630 16:667279-667301 CTGTGCCCTCCACGTGCCACTGG - Intronic
1132954216 16:2582604-2582626 CCTGCCCCTGCAGGTGGCCCCGG - Intronic
1132960129 16:2617559-2617581 CCTGCCCCTGCAGGTGGCCCCGG + Intergenic
1133258457 16:4533322-4533344 CCCTGCCCTGCAGGAGCTATGGG - Intronic
1136254500 16:29029271-29029293 ACTAGCCCTGCAACTGCCACGGG - Intergenic
1137584073 16:49653588-49653610 CCTTTCCCTGGAGGTGGCAAAGG - Intronic
1138075663 16:54039937-54039959 CCTTGACCAGCAGGTACCAATGG - Intronic
1139466206 16:67155367-67155389 CCTAGCCCAGCAGGTGCGGCCGG - Exonic
1139956730 16:70696849-70696871 CCCAGCCCGGCAGGTGCCAGCGG - Intronic
1141649520 16:85385601-85385623 GCTGGCCCTGGGGGTGCCACGGG - Intergenic
1142047046 16:87932214-87932236 CCTTGCCCGGCAGGTAGGACTGG - Intronic
1142387435 16:89774769-89774791 CCTGGCCCTGCAGGTGGAAGGGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1142876957 17:2856988-2857010 CCTTGCTCTGCAGGTGCTGGTGG + Intronic
1142960242 17:3548032-3548054 TCCTGCCCTGCAGCTGCTACAGG + Intronic
1143499587 17:7330797-7330819 TCTTGCCCTGCAGGTCCCCCAGG - Intergenic
1144583526 17:16473842-16473864 CCTTGCCCAGCAGGAGTCAGCGG + Intronic
1145282437 17:21477839-21477861 CCCTGCCCTGCAGATCTCACGGG + Intergenic
1145395033 17:22487916-22487938 CCCTGCCCTGCAGATCTCACGGG - Intergenic
1146180909 17:30697700-30697722 CCTTGCCCTGGTGGCTCCACTGG - Intergenic
1146393145 17:32441503-32441525 CTTTGCCCTGGAGATGCCATGGG + Intergenic
1147430420 17:40367208-40367230 CCTGACCCAGCAGGAGCCACGGG - Intergenic
1148153918 17:45411988-45412010 CATTGCCCTGCAGGTAGCATGGG + Intronic
1148440959 17:47711379-47711401 CCATGCCCTCCTGGTGCCCCTGG + Exonic
1148794570 17:50190824-50190846 CCTGGCCCTGCTGGTGCCCCTGG - Exonic
1148795670 17:50195574-50195596 CCTGGCCCTGCTGGTGCTGCTGG - Exonic
1150645973 17:66977717-66977739 CCTGGCCCTGCAGGTGCGTGTGG - Intronic
1151618911 17:75233045-75233067 CCGGGCCCTGCAGGTTCCTCAGG + Exonic
1152127178 17:78454251-78454273 CCTTTCCCTGCAGGAGCAGCAGG + Intronic
1152258844 17:79255724-79255746 CCCTGAGCTGCAGGTGCCCCCGG - Intronic
1152336849 17:79703584-79703606 CCCGGCTCTGCAGGTGCCACTGG - Intergenic
1152431932 17:80253077-80253099 CCCTCCCCCGCAGGTGGCACTGG - Exonic
1153556957 18:6324539-6324561 GCTTGCCCTGCATCTGCCATTGG - Intronic
1153845871 18:9049473-9049495 CCTTGCCCACCAAGTCCCACAGG + Intergenic
1153948518 18:10037672-10037694 GCTTGGCCTGCAGGTGCCTTGGG + Intergenic
1154499809 18:14990313-14990335 CCCTGCCCTGCAGGTCTCACAGG - Intergenic
1155120358 18:22813062-22813084 CCTTGCCCATCAGGTCACACAGG + Intronic
1155395287 18:25380206-25380228 GCTTGCATTCCAGGTGCCACTGG - Intergenic
1159048436 18:63393473-63393495 CCTTGCTCTCCAGGTGACCCTGG - Exonic
1159103813 18:63983053-63983075 CTTTGCCCTCCAGGTGCCATTGG + Intronic
1160544567 18:79644148-79644170 CGGAGGCCTGCAGGTGCCACGGG + Intergenic
1160834631 19:1118929-1118951 CGTGGCCTTGCAGATGCCACAGG - Intronic
1160918114 19:1507232-1507254 CCTGCTCCTACAGGTGCCACTGG - Exonic
1161088966 19:2350829-2350851 CCCTCCCCTGCGGGTGCCAAGGG + Intronic
1161120173 19:2521381-2521403 TCTTGCCCTCCAGGGGACACTGG + Intronic
1161133867 19:2608333-2608355 CCTTGCCTTGCAGGGGCTTCGGG - Intronic
1161164565 19:2779300-2779322 CCCTGCCCAGCATGTGACACAGG + Intronic
1161979918 19:7624965-7624987 CCTTGGCCTACACGTGCCCCTGG + Intronic
1162029096 19:7909750-7909772 CCTAGCCCTGCAGCTCCCGCTGG + Exonic
1162514286 19:11138817-11138839 CCCTGCCCTGCAGCTGGCCCTGG + Intronic
1162752886 19:12839279-12839301 CCTAGCCTTGCAGCTGCCACAGG + Intronic
1162977673 19:14217832-14217854 CCTTGCCCTGGTGGCTCCACTGG + Intergenic
1163423299 19:17226984-17227006 CCAGTCCCTGCAGCTGCCACAGG - Exonic
1163490587 19:17615072-17615094 CCTTCCCCTGCAGGGGTCCCGGG - Intronic
1164864054 19:31589290-31589312 CCTGGCCCTACAGGTGGCTCAGG + Intergenic
1165177963 19:33943792-33943814 CCTTGCCCTGCAGGTGCTCCCGG - Intergenic
1166071130 19:40388699-40388721 CCTTGCCCTCAGGGTGCCCCTGG + Intronic
1167460419 19:49621610-49621632 CCCAGCCCTGCAGGTGCCTGGGG + Exonic
1167669592 19:50842471-50842493 CCTTGCCCCCCAGGTCCTACAGG - Intergenic
925144669 2:1572975-1572997 CCTTGCCCTTCAGGAGGCAGAGG - Intergenic
926060644 2:9802715-9802737 CCAGGCCCTGCAGCTGACACTGG + Intergenic
927461069 2:23298586-23298608 CCATGCCCTGAAGGTTCCATGGG - Intergenic
927856103 2:26528907-26528929 CACTGCCCTGCAGATGCCACTGG - Intronic
928181613 2:29072288-29072310 ACTGACCCTGCAGGTGCCATTGG + Exonic
928786035 2:34887517-34887539 TCTTGCACCGTAGGTGCCACAGG - Intergenic
934074702 2:88418075-88418097 CCTTGCCCCACAAGTACCACAGG + Intergenic
934758529 2:96840647-96840669 CCTCCGTCTGCAGGTGCCACTGG + Intronic
937764313 2:125641724-125641746 CCCTCCCCTGCAGTTGGCACTGG + Intergenic
938406651 2:131036596-131036618 CCTGTCCCTGCAGGTGGGACTGG - Intronic
938493473 2:131777997-131778019 CCGTGCCCTGCAGGTCTCACAGG + Intergenic
938499017 2:131820668-131820690 CCCTGCCCTGCAGGTCTCACAGG - Intergenic
940985697 2:160049952-160049974 CCTTCCCCTGCCCCTGCCACAGG - Intronic
941414740 2:165206012-165206034 CCTTCCCCTGCAGGTTTCAGAGG - Intergenic
942318972 2:174719126-174719148 CCTAGCACTGCAGGTGGCTCTGG + Intergenic
942668170 2:178344426-178344448 CCCTGTCCTGATGGTGCCACTGG + Intronic
945152213 2:206803309-206803331 CCTGGCCCTGGAGATGCCAGAGG + Intergenic
945409139 2:209488406-209488428 ACTGGCCTTCCAGGTGCCACTGG - Intronic
947142454 2:227032019-227032041 CCTGGTCCTGCAGGTGCCACAGG - Exonic
947841331 2:233209617-233209639 TCTGTCCCTGCAGGTGGCACTGG - Intergenic
948005325 2:234603515-234603537 CCCTGGCCTGCAGGTGTCCCAGG - Intergenic
948693936 2:239723293-239723315 GTTTGCCTTGCAGGTCCCACTGG + Intergenic
948976844 2:241468664-241468686 GATTGCCCTGCAGGAGTCACAGG + Intronic
1171046392 20:21812147-21812169 CCTTGCACTGCGAGAGCCACTGG - Intergenic
1171487120 20:25493359-25493381 CCTATCCCTGTTGGTGCCACAGG - Intronic
1172599466 20:36173868-36173890 CCGTGGCCTGCAGGGGTCACAGG - Exonic
1172688966 20:36777699-36777721 CCTTGCCCTGGGGGTCCCCCAGG + Exonic
1173574969 20:44106953-44106975 CCTTGCTCTGGAGCTCCCACTGG + Intergenic
1173581989 20:44153643-44153665 CCATGCCCTGCCTCTGCCACGGG + Intronic
1174043002 20:47713195-47713217 TTTTGCCCTGCAGGGGACACTGG + Intronic
1174527096 20:51181473-51181495 CCTTCCCCTGCAATTGGCACAGG + Intergenic
1175423195 20:58848774-58848796 TGTGGCCTTGCAGGTGCCACAGG + Intronic
1175465837 20:59191080-59191102 CCTGGCCCTCCAGGGGCCCCAGG + Exonic
1175481325 20:59313309-59313331 CCTTGTCCAGCCGGAGCCACTGG - Intronic
1175775031 20:61647730-61647752 GCTTGCTCTGTAGGTACCACGGG + Intronic
1175789165 20:61730973-61730995 CCTTCCCCTGGAGCTGCCACAGG - Intronic
1176020508 20:62960359-62960381 CCCTGCCCTGCTGGTCCCTCGGG + Intronic
1176159480 20:63641136-63641158 GCTTCCCCTGCAGGAGCCGCCGG - Exonic
1176272706 20:64244758-64244780 CCCTACCCTGCAGCTGCCTCAGG + Intergenic
1176614428 21:9016393-9016415 CCCTGCCCTGCAGGTCTCACAGG - Intergenic
1176710773 21:10147477-10147499 CCCTGTCCTGCAGGTCTCACAGG + Intergenic
1178293130 21:31386620-31386642 CCTTGCCCTGCAGTTTGCAGGGG - Intronic
1178822005 21:35983865-35983887 CCTTGCCCCTCAAGTCCCACAGG - Intronic
1179919965 21:44502774-44502796 CCTTCTCTCGCAGGTGCCACCGG - Intronic
1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG + Intronic
1180497673 22:15904043-15904065 CCCTGCTCTGCAGGTCTCACAGG + Intergenic
1180970510 22:19812500-19812522 CCTTCCGCTGCAGGGGCCATGGG - Intronic
1181282846 22:21731998-21732020 CAAGGCCCTGCAGGTGCCAGAGG + Intronic
1181315707 22:21969797-21969819 CCTTCCACTACAGGTGCTACAGG - Intronic
1181412103 22:22731255-22731277 CCTTGGCCTGCTGGAGCCTCTGG - Intergenic
1181467411 22:23117630-23117652 CCTTGCCCTGTGGCTACCACTGG - Intronic
1181469408 22:23128550-23128572 CCTGGCCCTGCAGGGGCCCTGGG - Intronic
1181778988 22:25179107-25179129 GCTTCCCCTGCAGGAGCCGCCGG - Intronic
1183035017 22:35134848-35134870 CCGTGCCCTGCTGGTGACCCAGG - Intergenic
1183240448 22:36653763-36653785 CCTGGTCCTGAAGGTCCCACAGG - Intronic
1183307336 22:37089684-37089706 TGGGGCCCTGCAGGTGCCACAGG + Exonic
1183745086 22:39687368-39687390 AGCTGCCCTGCAGGTGCCCCTGG + Exonic
1183927578 22:41217027-41217049 CCTACCTCTGCAGGTCCCACAGG + Intronic
1183931280 22:41237529-41237551 CCGTTTCCTGCAGGTGCCAGGGG - Exonic
1183993567 22:41615739-41615761 CCTTGCCCTCCAGGAGCTCCAGG + Intronic
1184121050 22:42450603-42450625 CCCTCCCCAGCAGGTGGCACAGG + Intergenic
1184132883 22:42528329-42528351 CCCTCCCCAGCAGGTGGCACAGG + Intergenic
1184332708 22:43836148-43836170 CCTCACACTGCAGGTGCCACAGG + Intronic
1184332715 22:43836190-43836212 CCTCCGACTGCAGGTGCCACAGG + Intronic
1184332724 22:43836232-43836254 CCTCCAACTGCAGGTGCCACAGG + Intronic
1184332731 22:43836274-43836296 CCTCCAACTGCAGGTGCCACAGG + Intronic
1184332739 22:43836316-43836338 CCTCACACTGCAGGTGCCACAGG + Intronic
1184332746 22:43836358-43836380 CCTCCAACTGCAGGTGCCACAGG + Intronic
1184332754 22:43836400-43836422 CCTCACACTGCAGGTGCCACAGG + Intronic
1184332761 22:43836442-43836464 CCTCACACTGCAGGTGCCACAGG + Intronic
1184332767 22:43836484-43836506 CCTCCAACTGCAGGTGCCACAGG + Intronic
1184332775 22:43836526-43836548 CCTCACACTGCAGGTGCCACAGG + Intronic
1184332781 22:43836568-43836590 CCTCCAACTGCAGGTGCCACAGG + Intronic
1184332789 22:43836610-43836632 CCTCACACTGCAGGTGCCACAGG + Intronic
1184332795 22:43836652-43836674 CCTCCAACTGCAGGTGCCACAGG + Intronic
1184332808 22:43836730-43836752 CCTCACACTGCAGGTGCCACAGG + Intronic
1184332815 22:43836772-43836794 CCTCACACTGCAGGTGCCACAGG + Intronic
1184332822 22:43836814-43836836 CCTCACACTGCAGGTGCCACAGG + Intronic
1184332830 22:43836856-43836878 CCTGACACTGCAGGTGCCACAGG + Intronic
1184355472 22:43976836-43976858 CCTCACCCTGCAGGGGTCACAGG - Intronic
1185222880 22:49637687-49637709 CCTCCCGCTGCAGGTCCCACAGG + Intronic
1185282047 22:49976268-49976290 GCCTGCCCTGGAGGTGCCCCCGG - Intergenic
1185287392 22:50008641-50008663 GCTTTGCCTGCAGGAGCCACAGG - Exonic
949928030 3:9057548-9057570 CCCCTCCCAGCAGGTGCCACGGG + Intronic
953315835 3:41925523-41925545 TCTGGCCTTCCAGGTGCCACTGG - Intronic
953800434 3:46018621-46018643 CCCTGTCCAGCAGGTGCTACTGG + Exonic
954092071 3:48292974-48292996 CCTTGCCCTCCAAGTCCCACAGG - Intronic
954569763 3:51630892-51630914 CCTTGCCCCACAGTTGGCACGGG + Exonic
956663625 3:71622078-71622100 CCTTGCCCTTCAGGAGCCTGTGG - Intergenic
959495894 3:107051369-107051391 CCTTGCCAAGTAGGTCCCACAGG - Intergenic
959740048 3:109707976-109707998 CCTTGCCTTCCAAGTCCCACAGG - Intergenic
960177246 3:114532107-114532129 ACTGGCATTGCAGGTGCCACTGG - Intronic
960444329 3:117729406-117729428 CCTTGCTCTGCAGGTGTCTCAGG + Intergenic
961522975 3:127478619-127478641 CCCAGTTCTGCAGGTGCCACCGG - Intergenic
962530781 3:136277882-136277904 CCTGGCCCTGCAGGTGGCCTGGG - Intronic
962642385 3:137400842-137400864 CCTGGCATTCCAGGTGCCACTGG + Intergenic
964410120 3:156389235-156389257 CCTTTCACTGCAGCTGCAACTGG - Intronic
965017377 3:163174838-163174860 ACTGGCGCTCCAGGTGCCACTGG - Intergenic
965960667 3:174425048-174425070 CCTTGCCCTCCAGGAGAGACAGG - Intergenic
966493692 3:180556411-180556433 ACTGGCATTGCAGGTGCCACTGG - Intergenic
967881910 3:194307500-194307522 CCGGGCCCTGCAGGTGCTTCTGG - Intergenic
968230992 3:197004292-197004314 ACTAGGCCCGCAGGTGCCACTGG + Intronic
969865783 4:10076233-10076255 CCTTGGCCTGCGGGTGGCACAGG + Intronic
970685218 4:18559536-18559558 CCTGGCATTCCAGGTGCCACTGG - Intergenic
971259539 4:25043687-25043709 CCTTGCCAGGCATGTGCCACAGG - Intergenic
971637670 4:29083573-29083595 CCTTGCCCTGAAACTGCCATTGG - Intergenic
977168553 4:93730989-93731011 CTTTGCCCAGCAGGTGTCACGGG - Intronic
978450875 4:108832387-108832409 CATGGCCCTGCAGGTCCCAAAGG - Exonic
980237874 4:130131922-130131944 CCTTCCCCTGCAACTTCCACTGG + Intergenic
981087126 4:140695717-140695739 CCTTGGCCTTCAGTTGGCACAGG - Intronic
983913631 4:173267459-173267481 CCTGGCGCTGCAGAAGCCACTGG - Intronic
984618609 4:181927131-181927153 GCTTGCATTCCAGGTGCCACTGG - Intergenic
984756987 4:183333487-183333509 CCTTGCCTTGTGGCTGCCACTGG - Intergenic
985229337 4:187798529-187798551 CCATGCCCTGCAGCTGCTGCTGG - Intergenic
985645228 5:1081813-1081835 CACTCCCCGGCAGGTGCCACTGG + Intronic
985675895 5:1231204-1231226 CCTTCCACTGCGGGTGCCCCAGG + Intronic
985936789 5:3103455-3103477 CCTTCCCCAGCAGGTCCCCCAGG + Intergenic
987248786 5:16078506-16078528 CCCTGCCCTGCTGGTGCCCACGG + Intronic
988404337 5:30804871-30804893 CCAGGCCCTGTAGGTGGCACTGG + Intergenic
988469629 5:31526514-31526536 CCTTGTCCAGGAGGTGCCCCAGG + Exonic
990975079 5:61552890-61552912 TCTTGCCCTTCAGGTCCCACCGG + Intergenic
991299955 5:65120553-65120575 CCTTCCCCAGCAGGAGCCAGGGG + Intergenic
992140284 5:73789745-73789767 CCTTGCCCAGCAAGTCCCCCAGG + Intronic
996644706 5:125799589-125799611 CCTTGCCCTGCAAATCCCAAGGG + Intergenic
997401514 5:133606988-133607010 GCTTGGCCTGGAGTTGCCACTGG + Intronic
1001307478 5:170585891-170585913 CCAAGCCCTGCAGGAGCCAGTGG + Intronic
1002373412 5:178772189-178772211 CCCAGCCCTGCAGGTCCGACTGG - Intergenic
1002767981 6:259294-259316 CCTTTCCCTGCTGCTGACACTGG + Intergenic
1002844491 6:934909-934931 CCCTGCCCTTCAGGGGACACTGG + Intergenic
1003031339 6:2603981-2604003 CCCTTCACGGCAGGTGCCACAGG - Intergenic
1005989371 6:30893486-30893508 CTGTGCCCTGCAGGTCCCACTGG - Intronic
1006418616 6:33919778-33919800 CCTTGGCCTGCAGGTGGCACAGG + Intergenic
1006516609 6:34549081-34549103 CCTTGGCCTGCCAGTCCCACGGG + Intronic
1007109169 6:39303271-39303293 CCTGTCCCTGAAGGTGCCGCTGG - Intronic
1007186073 6:39973343-39973365 CAGTGCCCTTCAGGTGGCACAGG - Intergenic
1007343587 6:41209598-41209620 TCCTGACCTGCAGGTGCCACAGG - Intergenic
1007346717 6:41236596-41236618 TCCTGATCTGCAGGTGCCACAGG + Exonic
1007517968 6:42428714-42428736 CCTTGCCCTGCAGAAGTCAGAGG + Intronic
1007963702 6:45984623-45984645 CCTTGCCCTGCAGTGACCAGGGG - Intronic
1008444208 6:51569759-51569781 CCATGCTCTGCAGCTGCCAGTGG - Intergenic
1010795551 6:80113286-80113308 CCTTGGCCTTCAGGTAACACTGG + Intronic
1011174070 6:84540941-84540963 CCTGGCATTCCAGGTGCCACTGG - Intergenic
1012006806 6:93722680-93722702 CCTTGCCCTGCAGTTTCTAGTGG - Intergenic
1015945523 6:138496300-138496322 CATTCTCCTGCTGGTGCCACGGG + Exonic
1016885405 6:148955202-148955224 GCCTGGCCTGCAGGAGCCACTGG - Intronic
1017203780 6:151783373-151783395 TCTTGCCCTGCATGTACCAATGG - Intronic
1017402434 6:154079367-154079389 CCATGCAGTGCAGGTGCCTCTGG - Intronic
1018906194 6:168077595-168077617 CCAGGCCCAGCAGGGGCCACAGG + Intronic
1019196637 6:170287015-170287037 CCCTGCCCTGCGGGAGCCTCTGG - Intronic
1019307547 7:343096-343118 CCACCGCCTGCAGGTGCCACGGG - Intergenic
1019578910 7:1750525-1750547 CCTTGCCCTGCAGCTGGGATGGG + Intergenic
1021788780 7:24178943-24178965 CCATACCCTGCAAGGGCCACAGG + Intergenic
1022298930 7:29084208-29084230 CCGGGCCCTGCAGGATCCACTGG + Intronic
1022746554 7:33178615-33178637 ACATGCTCTGCAGGTGGCACAGG - Intronic
1028429994 7:90735845-90735867 CCTGGCATTCCAGGTGCCACTGG + Intronic
1028754445 7:94419522-94419544 CCTGGTCCTGCTGGAGCCACAGG + Exonic
1028920573 7:96306303-96306325 CCTTGCCCTGAAGGTCAGACTGG - Intronic
1029414365 7:100433724-100433746 CCTTGCTGCGCAGGTGCCAGAGG - Exonic
1029449284 7:100631936-100631958 CCTTTCCCTGCAGGTGCACCTGG - Exonic
1029453431 7:100655460-100655482 CAATGCCCTGCACGTGCCTCGGG - Exonic
1029478998 7:100801859-100801881 CCTGCCCCTGCAGGTGCCCGGGG + Intergenic
1029489174 7:100861128-100861150 CCTTGCCCAGCTGGTGCTCCTGG + Exonic
1032397659 7:131602247-131602269 CCCTACCTAGCAGGTGCCACAGG - Intergenic
1032478164 7:132226323-132226345 CCTTTTCCAGCAGGTGTCACTGG - Intronic
1034258148 7:149735648-149735670 CCTTGCCCTGCTGCTTCTACAGG - Intergenic
1035687745 8:1538066-1538088 CCGAGCCCTGCAGGTGCCCCAGG - Intronic
1036757705 8:11482254-11482276 ACTTCCCCTGCAGGTGGCTCTGG + Intergenic
1036808405 8:11850860-11850882 CCTTACCCAGCAGGAGCCACAGG + Exonic
1038446460 8:27607812-27607834 CCTTGCCCAGCAGGGGACAGGGG - Intronic
1038455428 8:27669493-27669515 CCTTGGCCTGCAGGAGCCCCTGG - Intronic
1038644064 8:29348947-29348969 CCCTGCCCTGCAGGTGTGGCGGG + Intronic
1039790513 8:40872317-40872339 CCCAGCCCTCCAGGTGCCAGCGG + Intronic
1040599322 8:48869198-48869220 CCGTCCACTGCTGGTGCCACTGG - Intergenic
1041155028 8:54977007-54977029 CCTGGCATTCCAGGTGCCACTGG - Intergenic
1041273918 8:56138067-56138089 CCTTGCCCTGCAGCCCCGACAGG + Intergenic
1043366349 8:79537460-79537482 GCTGGCCTTCCAGGTGCCACTGG + Intergenic
1043417961 8:80071115-80071137 CATTGCCCTGCACGTTTCACAGG + Intronic
1044835722 8:96293561-96293583 CCTTGTCCTGGAAGGGCCACAGG - Intronic
1045328768 8:101137355-101137377 CCTTGTCCTCCAGGCGGCACGGG + Intergenic
1046383567 8:113480535-113480557 CCTTGGCCTTCAGGTAACACTGG + Intergenic
1047993833 8:130314646-130314668 CCCCACCTTGCAGGTGCCACTGG - Intronic
1048436183 8:134420248-134420270 TCTTGGCCTGTAGGTACCACTGG - Intergenic
1048999743 8:139817156-139817178 CCATGCCTTGCAGGGGCCGCTGG + Intronic
1049312964 8:141943112-141943134 CCTGTGCCTGCAGGTGCCGCTGG + Intergenic
1049462875 8:142738269-142738291 CCTTGTCCTGGCGGAGCCACTGG + Intergenic
1053269421 9:36739956-36739978 CGTGGCCCCGCAGGTGCCATGGG - Intergenic
1053647756 9:40133173-40133195 CCCTGTCCTGCAGGTCTCACAGG + Intergenic
1053757975 9:41330670-41330692 CCCTGTCCTGCAGGTCTCACAGG - Intergenic
1054328731 9:63731124-63731146 CCCTGCCCTGCAGGTCTCACAGG + Intergenic
1054536824 9:66242997-66243019 CCCTGTCCTGCAGGTCTCACAGG - Intergenic
1057194923 9:93111548-93111570 CCCAGCCCTGCAGGTGGGACTGG + Intronic
1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG + Intronic
1059745219 9:117193793-117193815 CCTTGCCCTGCACGTGCTCCTGG + Intronic
1060262456 9:122088353-122088375 CCTTGCCCTCCAGGAGCTCCTGG - Intronic
1060265042 9:122107131-122107153 CCTGGCCTTCCAGGTGCCTCAGG + Intergenic
1061065979 9:128277642-128277664 CCCTGCCCTCCAGGAGCCACAGG + Intronic
1061130605 9:128705863-128705885 CCTTACCTTGGGGGTGCCACTGG - Exonic
1061257514 9:129461019-129461041 CCCTGCCCTCCAGGAGCCCCTGG + Intergenic
1062206779 9:135341868-135341890 GCCTGCCCTGCAGGTGCACCCGG - Intergenic
1062437250 9:136551802-136551824 CTTTGCCCCGGAGGAGCCACCGG + Intergenic
1062449644 9:136610096-136610118 CCCTTCCCTGCAGGTGCCTTAGG - Intergenic
1062540577 9:137040097-137040119 CCATGCCCTCGAGGTGCCAGTGG + Intronic
1062722547 9:138051929-138051951 CCTTGCCCTGCAGGTGCCACAGG - Intronic
1202795533 9_KI270719v1_random:116465-116487 CCCTGTCCTGCAGGTCTCACAGG + Intergenic
1186370165 X:8938303-8938325 CCTAGCTCTGCAGGTGACAATGG + Intergenic
1186599837 X:11024816-11024838 CCTGGCGTTCCAGGTGCCACTGG + Intergenic
1187261377 X:17687791-17687813 TGTTGCGCTGCTGGTGCCACGGG - Exonic
1190879691 X:54483525-54483547 CCTTTCCCTGCAGGGGCCATGGG + Intronic
1191980008 X:66915304-66915326 CCATGACAGGCAGGTGCCACAGG - Intergenic
1192431954 X:71118714-71118736 CCTGGCCCTGCTGGTGCCTCCGG + Exonic
1193003677 X:76591447-76591469 CCTGGCATTGCAGGTGCCACTGG + Intergenic
1193228456 X:79013450-79013472 GCTTGCATTCCAGGTGCCACTGG + Intergenic
1197401141 X:125992356-125992378 CCCTGACCTGCAGGTGGTACTGG - Intergenic
1199377186 X:147127064-147127086 CCTGGCATTCCAGGTGCCACTGG - Intergenic