ID: 1062722654

View in Genome Browser
Species Human (GRCh38)
Location 9:138052487-138052509
Sequence AGGGAGATGCTGGAGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062722646_1062722654 0 Left 1062722646 9:138052464-138052486 CCGGGACAGGTGCAGGGTGGTGG 0: 1
1: 0
2: 4
3: 59
4: 375
Right 1062722654 9:138052487-138052509 AGGGAGATGCTGGAGGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062722654 Original CRISPR AGGGAGATGCTGGAGGTGAG GGG Intronic
No off target data available for this crispr