ID: 1062723660

View in Genome Browser
Species Human (GRCh38)
Location 9:138058891-138058913
Sequence TCCCTTTGTTGTCTGTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062723653_1062723660 11 Left 1062723653 9:138058857-138058879 CCTGGCCAGCATGGGATGCCTGT 0: 1
1: 1
2: 2
3: 28
4: 196
Right 1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 194
1062723655_1062723660 6 Left 1062723655 9:138058862-138058884 CCAGCATGGGATGCCTGTGGAAT 0: 1
1: 0
2: 1
3: 13
4: 123
Right 1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 194
1062723651_1062723660 19 Left 1062723651 9:138058849-138058871 CCTTGCATCCTGGCCAGCATGGG 0: 1
1: 0
2: 2
3: 49
4: 373
Right 1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 194
1062723656_1062723660 -7 Left 1062723656 9:138058875-138058897 CCTGTGGAATCCTGTTTCCCTTT 0: 1
1: 0
2: 2
3: 24
4: 263
Right 1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062723660 Original CRISPR TCCCTTTGTTGTCTGTGGGC TGG Intronic
901637162 1:10675796-10675818 TCCCTTTGTTGGGGGTGGGGGGG - Intronic
903928443 1:26848597-26848619 TGCCTGTGTTGTCTGAGGGAAGG - Exonic
909075011 1:71042259-71042281 ACCCTTTGTTCTCATTGGGCTGG + Intronic
910195408 1:84634875-84634897 TGCCTTTTTTGCCTGTGGGCTGG - Intronic
910880013 1:91914847-91914869 TCCGTTTGTTGACTGATGGCTGG - Intergenic
911191625 1:94954496-94954518 TCACTGTGTTGTCTGTGTTCTGG + Intergenic
912043571 1:105422509-105422531 TGCCTTTTTTGTCTGTGTGATGG - Intergenic
913329030 1:117652260-117652282 TCTCTCTGTTGACTGTGGGCAGG - Intergenic
913413820 1:118582565-118582587 TCCTATTGTTGTCACTGGGCTGG + Intergenic
915974030 1:160373247-160373269 CCCCTTTATTGTCTCTAGGCTGG + Intergenic
917135889 1:171787736-171787758 TCCCCTTTCTGTCTGTGGGTGGG + Exonic
920826512 1:209428180-209428202 TCCCTTTCATGTCTGGGGGTGGG - Intergenic
921047617 1:211488725-211488747 TCCCTCTTTTGTCTGGGAGCCGG + Intronic
922928531 1:229371004-229371026 GCCCTTTTTTGTGTGTGTGCAGG - Intergenic
923467541 1:234262730-234262752 TCCGGTTGTGGTCTGAGGGCAGG + Intronic
1062804571 10:407948-407970 TCCTTTTGTTGCCTGTGGTTCGG + Intronic
1063577925 10:7278618-7278640 CCCCATTGTTTTCTGTGAGCTGG - Intronic
1063617044 10:7609286-7609308 TACATTTATTGTTTGTGGGCTGG + Intronic
1065165842 10:22976160-22976182 GCCCTTCATTGTCTGTGGCCTGG + Intronic
1065316309 10:24467261-24467283 TCCGTGTGCAGTCTGTGGGCAGG + Intronic
1067476563 10:46571289-46571311 TCCCTTCCATGTCTGTGGGTTGG + Intergenic
1067618175 10:47770492-47770514 TCCCTTCCATGTCTGTGGGTTGG - Intergenic
1068116802 10:52744808-52744830 TTCCGTTGATGTCTGTGGGAAGG - Intergenic
1070756071 10:78994005-78994027 CCCCTTTGATTTCTGTGGGATGG + Intergenic
1070784939 10:79157497-79157519 TCCCCTTGTTGTCCATGGGGAGG + Intronic
1072617542 10:97059701-97059723 TCCCTGTGCAGTCTGAGGGCTGG + Intronic
1073676816 10:105656895-105656917 TCACTTTTTTGTCTGTTGGATGG + Intergenic
1074669637 10:115774915-115774937 TTCCTTTGATGCCTGTGGGATGG - Intronic
1075914319 10:126154324-126154346 TCCATGTGTTTTCTTTGGGCTGG + Intronic
1076866247 10:133167790-133167812 TCCCTCTGGTGTCTGAGGGTAGG - Intronic
1077359741 11:2135518-2135540 TCCCATTGGTGTCTGGGGGCGGG + Exonic
1078558831 11:12353333-12353355 TCCCTTGCTTGTCTCTGTGCTGG + Intronic
1078920779 11:15828366-15828388 TCCCTTTTGTTCCTGTGGGCTGG + Intergenic
1080024677 11:27600873-27600895 TCCCTTTGTGGTTTGTGGGTGGG - Intergenic
1083398398 11:62406943-62406965 TCCTTTTCTTGTCTGGGGGTGGG - Intronic
1084700317 11:70782564-70782586 TGCCTTTTTTTTCTGGGGGCTGG - Intronic
1085054241 11:73394713-73394735 TCACCATCTTGTCTGTGGGCAGG + Exonic
1085296376 11:75434020-75434042 GACCTCTGCTGTCTGTGGGCAGG - Intergenic
1089781299 11:120874992-120875014 TGCCTTGGCTGTGTGTGGGCAGG + Intronic
1089931223 11:122314454-122314476 TCCCTTTGTAGTACCTGGGCTGG - Intergenic
1090947416 11:131443628-131443650 TCCCTTTCCTAACTGTGGGCTGG + Intronic
1091243441 11:134069885-134069907 TACCTTTTTTGTCTCTGGCCTGG + Intronic
1092225859 12:6748084-6748106 TTCTTTTGATGTGTGTGGGCAGG + Exonic
1093032967 12:14305624-14305646 TCCCTTTGTTGTTTTAGTGCTGG + Intergenic
1094490918 12:30960108-30960130 ACCCTGTGGTGTCTGTGGGTGGG + Intronic
1095420455 12:42019019-42019041 GCCCTCTGATGTCTGGGGGCTGG - Intergenic
1096829121 12:54300841-54300863 TCCCGGTGTTGTCTCTGGGGAGG + Intronic
1097835919 12:64272674-64272696 CCCCTTTGTTTTCTGTGTGGTGG - Intronic
1099018843 12:77378474-77378496 GCCCTCTGTTGTCTGTAGCCTGG + Intergenic
1099654199 12:85468594-85468616 TCCCTTCTCTGCCTGTGGGCTGG + Intergenic
1101944376 12:109125107-109125129 TCCTTTTTTTGTGTGTGGGCGGG + Intronic
1102324454 12:111967845-111967867 GCCCTTTGTTGTCTGATGTCTGG - Intronic
1103877666 12:124141159-124141181 TCCTTTGGATGTCTGTGGCCAGG + Intronic
1104488112 12:129169275-129169297 TCCTTTACTTGTCTGTGGACTGG + Intronic
1104947469 12:132422564-132422586 TCCCCTTGTTTTCTGTGAGTTGG - Intergenic
1105500965 13:20971574-20971596 ATCATTTGTTGTCTGTGGGGAGG + Intergenic
1105973668 13:25454172-25454194 TCCCTGTGTTGTTTGTGGCTGGG + Intronic
1106216783 13:27708798-27708820 TGCCTTTGTTGTCTGGGGGTGGG - Intergenic
1108174378 13:47777323-47777345 TCCCCTTTCTGTCTGTGGTCAGG - Intergenic
1109580725 13:64329632-64329654 TACCTTTGTTTGCTGTGGGCGGG + Intergenic
1109707634 13:66118245-66118267 TCCCTTTCTTCTCTGTTGCCTGG + Intergenic
1110012044 13:70348913-70348935 TACCTTTGTTGTTTATGGGATGG - Intergenic
1113601531 13:111572679-111572701 TTCCTTTGTGTTCAGTGGGCTGG - Intergenic
1117889235 14:60399806-60399828 CCCCTTCCTTGTCTGGGGGCTGG + Intronic
1121877885 14:97470666-97470688 TTCCTTTCTTGAATGTGGGCTGG - Intergenic
1122029854 14:98904205-98904227 ACCCTTTGCTGTCTATGGCCCGG - Intergenic
1123456814 15:20433697-20433719 TCTCTTTGTTCTCTGGGGCCAGG - Intergenic
1123661248 15:22566659-22566681 TCTCTTTGTTCTCTGGGGCCAGG + Intergenic
1123939381 15:25209458-25209480 CTCCTTTGTTGGCTGTGAGCTGG + Intergenic
1124315048 15:28660895-28660917 TCTCTTTGTTCTCTGGGGCCAGG + Intergenic
1124468322 15:29960710-29960732 TTCCTGTGGAGTCTGTGGGCAGG - Intronic
1130310373 15:82748236-82748258 TTCCATTGTTGTCTGAGAGCAGG - Intergenic
1130731137 15:86493302-86493324 TCACTTTCTTGTTTGGGGGCTGG + Intronic
1133199144 16:4191784-4191806 TTCCTTTGTTCCCTGTGAGCTGG - Exonic
1133969617 16:10558385-10558407 TCTCTTTGTTATCTGGGGTCAGG - Intronic
1134276249 16:12779246-12779268 TCTCTCTGTTGTCTGGAGGCTGG + Intronic
1135176492 16:20234207-20234229 TTACTTTGTTGATTGTGGGCCGG - Intergenic
1139103092 16:63792449-63792471 TCCCTTAGTTGTCTTTCAGCTGG + Intergenic
1139574472 16:67832424-67832446 GCCCTTTGGGGTCAGTGGGCTGG + Intronic
1139964578 16:70738321-70738343 TCACTTTCTCATCTGTGGGCCGG + Intronic
1141866426 16:86753020-86753042 TCCCTTTGGGGTCTGGCGGCCGG + Intergenic
1142565133 17:835393-835415 TTTCTTTGTTCTCTGTGGCCTGG - Intronic
1147018388 17:37510844-37510866 TCCCCTGGGTGTGTGTGGGCAGG + Intronic
1147553838 17:41463900-41463922 TCCCTTTTTTATCTCTGAGCTGG + Intronic
1148800739 17:50223926-50223948 TCCCATTGTTTTCTGTGGGGAGG + Intergenic
1150136160 17:62696478-62696500 TCCCTTAGTCATCTCTGGGCAGG - Intergenic
1150646836 17:66983939-66983961 TCCCTTTGTGGGCTGTTGTCTGG + Intronic
1151326113 17:73380667-73380689 GCCCTCTGTTGGGTGTGGGCTGG - Intronic
1151333226 17:73423549-73423571 TCCCTATGTGGTCTGCAGGCAGG + Intronic
1151552467 17:74830051-74830073 TCTCTTCGGTCTCTGTGGGCAGG - Intronic
1151966443 17:77434083-77434105 TGGGTTTGGTGTCTGTGGGCTGG + Intronic
1152809246 17:82373863-82373885 TCACTTTCTTGTCTGTGCACAGG - Intergenic
1155865596 18:30960767-30960789 ACCCCTTGATGTCTGTGGCCTGG - Intergenic
1156442488 18:37205464-37205486 TCCCTTGTTTGTCTGATGGCAGG - Intronic
1156553802 18:38045124-38045146 TCACTTTTTTGTGTGTGCGCTGG - Intergenic
1157411006 18:47463468-47463490 TGCCATTCTTGTCTCTGGGCTGG + Intergenic
1158409472 18:57192717-57192739 TTCCTTTGTTCCCTGTGGGTGGG - Intergenic
1161455703 19:4368712-4368734 TCCCTTTCCTGCCTGTGGGTTGG + Intronic
1162033148 19:7925903-7925925 TCCCTTTGTTCTCGGCGGCCTGG + Intronic
1162122692 19:8481451-8481473 TCCAGTTGTGGTCTGTGGGGAGG + Intronic
1163791082 19:19306426-19306448 TCCCTTGGAGGTCTGTGGCCAGG + Intronic
1164521910 19:28985990-28986012 TCCCCTTCTTGTCTGTGGGTGGG + Intergenic
1165945320 19:39438188-39438210 TCTCTTTTTTGTCTGAGGGTTGG - Intronic
1166055055 19:40283699-40283721 TCTTATTGTGGTCTGTGGGCTGG - Intronic
1167718652 19:51161853-51161875 TGCCTTTGTTGCCTGTGGTTTGG + Intergenic
926324224 2:11770424-11770446 GCCCTTTGCTGTCCGTGGGCTGG - Intronic
929030689 2:37647797-37647819 TCCCTTTGCTGGCTGTGGAGAGG + Intronic
931018906 2:58020153-58020175 TCCTTTTGTTTTCAGTGGGTAGG - Intronic
932336074 2:70932122-70932144 TCCCTTTGTTCTCTCTGACCTGG - Intronic
932394074 2:71427269-71427291 TCCCTTTTTTATCTGTGGGATGG - Exonic
932617589 2:73244310-73244332 TTCTTTTGTGCTCTGTGGGCTGG - Intronic
932863029 2:75314067-75314089 ACCCTTTGTTGTCTATGTGTTGG - Intergenic
932907932 2:75774176-75774198 TCCTTTTGTTGTATGAGGGTAGG + Intergenic
935697998 2:105786647-105786669 TCCCTGTGGTGGCTGTGGCCTGG + Intronic
937391972 2:121496790-121496812 TCCCTCTGTTAAGTGTGGGCAGG - Intronic
942885085 2:180913457-180913479 TCTCATTGTTTTCTGTGGGAGGG - Intergenic
943827414 2:192413970-192413992 TCCCTGTGTTCTCTGGGGCCCGG + Intergenic
945550457 2:211215278-211215300 AGCCTTTGTCTTCTGTGGGCAGG - Intergenic
947891812 2:233629748-233629770 TCACTTTGTTTTGTGTGGGAAGG + Intronic
948211125 2:236193913-236193935 TCCCAGTGTTGTGTGTGGGTGGG + Intergenic
948279392 2:236734913-236734935 TCCCATGGATGTCTGTGGGTTGG + Intergenic
948915986 2:241035321-241035343 TCCGTTTGTGCACTGTGGGCTGG - Intronic
1169488084 20:6050341-6050363 TCCCTTGGAAGTCTATGGGCAGG - Intronic
1169910687 20:10645293-10645315 TCCCTCTGTCTTCTGTGGGAGGG - Intronic
1170143802 20:13151399-13151421 TCCATTCATTGTCTGTGGTCAGG + Intronic
1171501411 20:25596296-25596318 TCCTTTTCTTGACTGTGGGCTGG - Intergenic
1173872935 20:46352902-46352924 TCCCTTACTGGTCTGTGGGGAGG + Intronic
1174106151 20:48163844-48163866 TCTTTATGTTGCCTGTGGGCAGG - Intergenic
1174137925 20:48393275-48393297 TCCCTTTGCTGGGTGGGGGCAGG - Intergenic
1175444921 20:59013370-59013392 TCCCTCTGGTGACTGTGGGAAGG + Intergenic
1176041703 20:63069078-63069100 TCCTTGTGCTGTCTGTGGGATGG - Intergenic
1177654444 21:23999589-23999611 TGCATTTGTTGTCTGTAGGAAGG - Intergenic
1178568508 21:33712383-33712405 TCTCTATGCTGTCTGTGGACAGG + Intronic
1182073228 22:27477682-27477704 GCCCTCTCTTGCCTGTGGGCAGG + Intergenic
1182375400 22:29843594-29843616 CCCATATGTTGTCTGTGGGTTGG + Intergenic
1183543084 22:38441143-38441165 TCCCTCTCCTGTCTGTGAGCTGG - Intronic
1183793680 22:40097124-40097146 GGACTGTGTTGTCTGTGGGCTGG + Intronic
1184046077 22:41972977-41972999 TACCTTTGTATTCTGTGGCCAGG - Intergenic
1184669706 22:46006320-46006342 TCCCTCTCTTGTGTGTGGGAGGG + Intergenic
1185223640 22:49641217-49641239 TCCCTGGGGTGTCTGTGGGCAGG - Intronic
951221382 3:20072118-20072140 TTCTTTTGTTGTCTGCTGGCTGG - Intronic
951269008 3:20602749-20602771 TGCCCTTGTTGTCTTTGTGCTGG - Intergenic
953107454 3:39898112-39898134 TGCCTTTGCAGTCTGTGGGTAGG + Intronic
958032070 3:88123494-88123516 TCCCATAGTTGCCTGTGGGTGGG + Intronic
958265542 3:91433428-91433450 TCCCTTTCCTTTCTGTGGTCAGG - Intergenic
958588478 3:96121677-96121699 CCCTTTTGTTGGCTGTGGGCTGG - Intergenic
959858660 3:111191576-111191598 TCCCTTTGTAATCTGTGTGGGGG + Intronic
961450320 3:126999602-126999624 GCCCTTTGTTGGCTCTGGGCGGG + Intronic
964704764 3:159606429-159606451 TCCAAATGCTGTCTGTGGGCTGG - Intronic
966628172 3:182042418-182042440 TCTGTTTGTTGTCTGTGGGTGGG - Intergenic
967357090 3:188583752-188583774 TCACTTTGTTGTATGTGCACTGG - Intronic
969254846 4:5994697-5994719 TGCCCTCGTTGTCTGTGGACAGG - Intergenic
969386695 4:6854975-6854997 ACCCTTTGTTGTCTCCTGGCAGG - Intronic
970204400 4:13641693-13641715 TCCCTCTGCTCTATGTGGGCTGG + Intergenic
971291527 4:25345913-25345935 CCCCTTTGCTGTCTGTGCTCAGG + Intronic
973015485 4:45132606-45132628 TCCCTTTTTTGCTTGAGGGCTGG + Intergenic
973969577 4:56198674-56198696 TCCCTTTATTGTCTGTAAGATGG + Intronic
974080505 4:57207562-57207584 TGCCTTTGCTGCCTGTGGGTGGG - Intergenic
975852674 4:78588479-78588501 TTCCTTTGTTGTCTCAGGTCTGG - Intronic
983970553 4:173866619-173866641 TGCATTTGTTTTCTGTGGGCTGG + Intergenic
985096579 4:186418256-186418278 TCCCTTTGTCGTCTCTTGGTTGG + Intergenic
985792065 5:1934256-1934278 TCCCTGCCTTGTGTGTGGGCTGG + Intergenic
987464187 5:18252772-18252794 TCCCTTTGCTGTGTGTAGCCTGG + Intergenic
988290998 5:29286607-29286629 TCCCATTGTTGTCTCTGGCCAGG + Intergenic
989843043 5:46105390-46105412 GCCATTTGCTGGCTGTGGGCTGG + Intergenic
992445188 5:76827149-76827171 CCCACTTGTTGACTGTGGGCTGG + Intronic
993357526 5:86932936-86932958 TACCTGAGTTTTCTGTGGGCAGG - Intergenic
998367277 5:141639628-141639650 CCACTGTGTTCTCTGTGGGCAGG + Exonic
999128573 5:149265266-149265288 TTCCTTTGCTGTCTGTGTGAGGG + Intergenic
1002341120 5:178517092-178517114 TCTGTTTCTTGGCTGTGGGCAGG - Intronic
1005456869 6:26028771-26028793 TCACTTTGTTGTGACTGGGCAGG + Intergenic
1006300750 6:33192539-33192561 TCCCTTCGGTGGCTGTGGGCGGG - Intergenic
1008989823 6:57589228-57589250 TCCCTTTCCTTTCTGTGGTCAGG + Intronic
1009178405 6:60487772-60487794 TCCCTTTCCTTTCTGTGGTCAGG + Intergenic
1012741849 6:103027254-103027276 ATACTTTGCTGTCTGTGGGCCGG + Intergenic
1013539122 6:111089886-111089908 ATCCTTTGGTGTCTGTGGGTGGG + Intronic
1013542270 6:111122453-111122475 GCCCTTTGTTCACTGTGGGCTGG + Intronic
1018107905 6:160506703-160506725 TGCCCTTGCTGTCTGTGGACTGG - Intergenic
1018146936 6:160900381-160900403 TGCCCTTGCTGTCTGTGGACTGG + Intergenic
1019630608 7:2046954-2046976 TTCCTTTGTCGTCTGTGAGTGGG - Intronic
1028876096 7:95824978-95825000 TCCCATTATTATCTGTGGGGTGG - Intronic
1032160285 7:129504303-129504325 CCCCTTGGCTGCCTGTGGGCTGG + Intronic
1033545897 7:142399955-142399977 GCCCTTTGTCTGCTGTGGGCAGG + Intergenic
1033548590 7:142425043-142425065 GCCCTTTGTCTGCTGTGGGCAGG + Intergenic
1034089022 7:148346937-148346959 TCTCTTTGCTGTCTTTGGGAGGG - Intronic
1037577491 8:20221581-20221603 TCACTTTTTTCTCTGAGGGCTGG + Exonic
1037724642 8:21473155-21473177 TCCATGTGTGGTCTGTGGACCGG + Intergenic
1039533460 8:38286065-38286087 TCCCCTTGTTGCATGTGAGCAGG + Intronic
1039683079 8:39763789-39763811 TGCCTTTGTTGTCAGTGAACCGG - Intronic
1042976707 8:74478164-74478186 TGCCATTGTTGTCTGTTGGCAGG - Intronic
1046009110 8:108524774-108524796 TTCCTTTCTTGGCTGTGGGAAGG + Intergenic
1047907971 8:129493166-129493188 TCCCTTAGATGTGTGTGGGAGGG + Intergenic
1048454324 8:134564358-134564380 TCCCCTTGCTGTCTGTGGCAAGG + Intronic
1049151592 8:141038523-141038545 GCCCTTAGTGGCCTGTGGGCTGG + Intergenic
1049270401 8:141692669-141692691 TCCCTTCGGTGCCTGTGGGCCGG + Intergenic
1049420316 8:142513546-142513568 TCCCTCTGAGGGCTGTGGGCTGG + Intronic
1051078292 9:13266194-13266216 TCCCTTTGCTGAATGTGGACAGG + Intronic
1052807554 9:33025816-33025838 TCCCTTTGTTTGTTGAGGGCTGG + Intronic
1053354028 9:37431509-37431531 TCCCTTTGATGGCTGTGGTTAGG + Intronic
1057522563 9:95771842-95771864 TCCCCTGGCTGTCTGTCGGCAGG - Intergenic
1058670668 9:107358188-107358210 TTCCTGTGTTTTCTGTGGGGAGG + Intergenic
1061912932 9:133734562-133734584 TCCCTGTCTTTTCTGTGGGCTGG - Intronic
1062122753 9:134842461-134842483 TCCCTCTGTTCTCTCCGGGCTGG - Exonic
1062624861 9:137438156-137438178 GCACCTTGATGTCTGTGGGCAGG + Exonic
1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG + Intronic
1189148500 X:38680183-38680205 TACATTTGTAGTCTGTGTGCAGG - Intronic
1189354911 X:40303279-40303301 TCACTGTGTTGTTTGTGGGGAGG + Intergenic
1189517754 X:41732480-41732502 TCCCTTTGTGGTTTGCCGGCAGG - Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190591242 X:52003920-52003942 TCTCTTTGTTCTCTGTGGTCTGG + Intergenic
1191225279 X:58035671-58035693 TGCCTTCCTTGTCTGTGGGTGGG + Intergenic
1191893733 X:65971382-65971404 TCTCTTTCTTGTCTGCGGGGCGG + Intergenic
1194692040 X:96999104-96999126 TCCCTATAGTGTCTGTGAGCTGG + Intronic
1195088116 X:101432155-101432177 TCCCTTTTATGGCTGTAGGCAGG + Intronic
1197720228 X:129739951-129739973 TTTCTTTGTTGTCTGTCAGCAGG + Intronic
1200869123 Y:8078106-8078128 TCACTATGTTCTCTGGGGGCAGG + Intergenic
1201363294 Y:13176428-13176450 TCTCCTTATTGTCTGTGGACTGG - Intergenic
1202073673 Y:21017311-21017333 TCACTATGTACTCTGTGGGCAGG + Intergenic
1202078373 Y:21059165-21059187 TCACTATGTACTCTGTGGGCAGG + Intergenic