ID: 1062723843

View in Genome Browser
Species Human (GRCh38)
Location 9:138059847-138059869
Sequence AGAACCCCCTGGACATGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062723833_1062723843 11 Left 1062723833 9:138059813-138059835 CCAGGCCCTGTGTTAGCCTCTTC 0: 1
1: 0
2: 0
3: 38
4: 427
Right 1062723843 9:138059847-138059869 AGAACCCCCTGGACATGTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 136
1062723835_1062723843 6 Left 1062723835 9:138059818-138059840 CCCTGTGTTAGCCTCTTCCTGGG 0: 1
1: 0
2: 1
3: 24
4: 211
Right 1062723843 9:138059847-138059869 AGAACCCCCTGGACATGTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 136
1062723831_1062723843 25 Left 1062723831 9:138059799-138059821 CCCTCAGTGCATCTCCAGGCCCT 0: 1
1: 0
2: 2
3: 31
4: 301
Right 1062723843 9:138059847-138059869 AGAACCCCCTGGACATGTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 136
1062723832_1062723843 24 Left 1062723832 9:138059800-138059822 CCTCAGTGCATCTCCAGGCCCTG 0: 1
1: 0
2: 6
3: 43
4: 415
Right 1062723843 9:138059847-138059869 AGAACCCCCTGGACATGTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 136
1062723837_1062723843 5 Left 1062723837 9:138059819-138059841 CCTGTGTTAGCCTCTTCCTGGGT 0: 1
1: 0
2: 0
3: 11
4: 189
Right 1062723843 9:138059847-138059869 AGAACCCCCTGGACATGTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 136
1062723830_1062723843 26 Left 1062723830 9:138059798-138059820 CCCCTCAGTGCATCTCCAGGCCC 0: 1
1: 0
2: 1
3: 48
4: 285
Right 1062723843 9:138059847-138059869 AGAACCCCCTGGACATGTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 136
1062723838_1062723843 -5 Left 1062723838 9:138059829-138059851 CCTCTTCCTGGGTTCCGCAGAAC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1062723843 9:138059847-138059869 AGAACCCCCTGGACATGTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062723843 Original CRISPR AGAACCCCCTGGACATGTGG AGG Intronic
900472988 1:2863680-2863702 AGAAGCCCCAGTCCATGTGGGGG + Intergenic
906836214 1:49085849-49085871 AGAGCCACCTGGACATTTTGTGG + Intronic
908034274 1:60035082-60035104 GGAACTCCCTGGACAGGTGAAGG - Intronic
913703804 1:121398058-121398080 AGATCCCCCTGGAAATTAGGTGG + Intergenic
913980155 1:143499767-143499789 AGATCCCCCTGGAAATTAGGTGG + Intergenic
914074503 1:144325252-144325274 AGATCCCCCTGGAAATTAGGTGG + Intergenic
914104673 1:144641194-144641216 AGATCCCCCTGGAAATTAGGTGG - Intergenic
915060311 1:153176384-153176406 AGAGCACCTTGGACAGGTGGGGG - Intergenic
917829518 1:178865118-178865140 GGCACCACCTGGACAAGTGGGGG + Exonic
919931783 1:202225810-202225832 AGAACCACCAGGACTTGGGGAGG - Intronic
920568132 1:206992652-206992674 AGAACACCATGGACACATGGAGG - Intergenic
924611935 1:245580587-245580609 AGAACCCCCTTGCCCTCTGGAGG - Intronic
1062794825 10:336798-336820 TGAACACCCTGGCCCTGTGGAGG + Intronic
1066157256 10:32691298-32691320 AGAACCTCCTGGCCAGGTAGTGG - Intronic
1067090329 10:43263082-43263104 AGAACCCAGAGGACAGGTGGGGG + Intronic
1067797380 10:49330563-49330585 ACAAGCCCCTGGTGATGTGGAGG - Intergenic
1071764476 10:88647209-88647231 AGAACTCCCAGGTCATGAGGTGG + Intergenic
1071899637 10:90106522-90106544 AGATCCCCCATGACATGTGGGGG - Intergenic
1073874025 10:107900383-107900405 AGAACTCCCTTGATTTGTGGAGG - Intergenic
1074643969 10:115422856-115422878 AGAACCTACTGGAGAGGTGGAGG + Intronic
1074930201 10:118117184-118117206 AGAACCTGTTGGACCTGTGGGGG + Intergenic
1074941309 10:118238331-118238353 AGAACACCCTGGACATGAGTCGG - Intergenic
1075594387 10:123717574-123717596 TTAACCCCAGGGACATGTGGTGG + Intronic
1076804351 10:132847622-132847644 AGAGCCCCCTGGGAATGTGTTGG - Intronic
1077378643 11:2217573-2217595 AGCACCCCCTGGGCATGGGACGG - Intergenic
1077423414 11:2463409-2463431 AGCACCCACAGGACAAGTGGTGG + Intronic
1077755428 11:5023884-5023906 GGAACCTCCTGGCTATGTGGTGG + Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1080349283 11:31364233-31364255 AGAAGCTCCTTGACATGTGATGG - Intronic
1080667119 11:34345604-34345626 AGCACCCACTGGACAGGTGGGGG + Intronic
1087677556 11:101180415-101180437 AGACAACCCTGGACATGTGGTGG + Intergenic
1091997093 12:5002214-5002236 AGAAGAGCCTGGACATGTGCTGG + Intergenic
1092166872 12:6347915-6347937 AGAGCCCCCTGGAGATGGGCGGG + Exonic
1094858406 12:34431499-34431521 AGAACCTCCTTGAGCTGTGGTGG - Intergenic
1095192152 12:39270259-39270281 GGAACCCCCTGGTCATGGGTTGG - Intergenic
1096178901 12:49539983-49540005 TGAACCCCCTAGACTTGGGGAGG + Intronic
1104811260 12:131621567-131621589 GGAACCCCCTGGGGGTGTGGTGG - Intergenic
1106032535 13:26016211-26016233 ACAACACGCTGGAAATGTGGTGG + Intronic
1106364052 13:29060253-29060275 AGAGCCACCTGGACATTTTGTGG - Intronic
1113126619 13:106986374-106986396 CGAGCCCGCAGGACATGTGGAGG - Intergenic
1113540092 13:111100532-111100554 AGAGCCACCTGGACATTTTGTGG + Intergenic
1114039202 14:18660632-18660654 AGAAGGCCCTGGACATGAGTAGG - Intergenic
1115481113 14:33862125-33862147 AGAACCCACTGAACTGGTGGTGG - Intergenic
1118877523 14:69797617-69797639 ATAACCCACTGGACATGGGGAGG - Intergenic
1121495956 14:94391367-94391389 AGGAACCCCAGGACATGAGGGGG + Intergenic
1122941292 14:104982558-104982580 AGGACCCCCTGACCAGGTGGGGG + Intergenic
1123393476 15:19900308-19900330 AGATCCCCCTGGAAATTAGGTGG + Intergenic
1124379651 15:29154936-29154958 AGAACCCCATGCACATGTGAAGG + Intronic
1125679911 15:41524060-41524082 AGGACCCACAGGACAGGTGGAGG - Intronic
1130617313 15:85423559-85423581 AGAAGTCACTGGACATGTGGTGG - Intronic
1131095068 15:89649479-89649501 AGTACCCCGTGGGCATGGGGAGG - Intronic
1132803955 16:1767142-1767164 AGATCCCACTGGCCATCTGGAGG - Exonic
1135649381 16:24192627-24192649 AGAACCCAGCGGACATCTGGGGG + Intronic
1136699477 16:32117682-32117704 AGATCCCCCTGGAAATTAGGTGG + Intergenic
1136799968 16:33060853-33060875 AGATCCCCCTGGAAATTAGGTGG + Intergenic
1136957866 16:34804863-34804885 AGATCCCCCTGGAAATTAGGTGG + Intergenic
1140487842 16:75308132-75308154 AGTACTGCCTGGACAGGTGGTGG + Intronic
1141603426 16:85139639-85139661 AGACCCCCTTGGCCAGGTGGTGG + Intergenic
1141773962 16:86110021-86110043 AGAACTCATTGGACATGTGTAGG - Intergenic
1142220755 16:88853837-88853859 AGCTCCCCCTGGACAGGTGGGGG + Intronic
1142373835 16:89696920-89696942 AGAATCCCTGGGACACGTGGAGG + Exonic
1203070567 16_KI270728v1_random:1072268-1072290 AGATCCCCCTGGAAATTAGGTGG - Intergenic
1143387944 17:6543213-6543235 AGACCACCCTGGACCTGAGGTGG - Intronic
1143531797 17:7509380-7509402 AGAACCCCCTGGAAAGGGGAAGG - Intronic
1145794819 17:27649469-27649491 AGAACACTCTGGTCAGGTGGTGG - Exonic
1145998166 17:29116190-29116212 AGAACCCCGTGTGCCTGTGGGGG + Intronic
1149702670 17:58668411-58668433 ATAAACCCCTGCAAATGTGGAGG + Intronic
1151367875 17:73628920-73628942 AGACCCCCCTGGACGTGAGCTGG + Intronic
1154518090 18:15196769-15196791 AGATCCCCCTGGAAATTAGGTGG - Intergenic
1157801746 18:50626781-50626803 AGAGCCCCCTGAACATCTTGAGG - Intronic
1161322224 19:3646556-3646578 ACAACCCCAGGGACATGCGGCGG + Intronic
1202679990 1_KI270712v1_random:1703-1725 AGATCCCCCTGGAAATTAGGTGG - Intergenic
925862884 2:8197490-8197512 AGAAGCATCTGGACATGTGGAGG - Intergenic
935594447 2:104868146-104868168 AGAACCCCATGGGGGTGTGGGGG - Intergenic
939260680 2:139804930-139804952 AGAGAACCCTGGAAATGTGGTGG + Intergenic
940309097 2:152258395-152258417 AGACCAGCCTGGACATATGGGGG - Intergenic
945337100 2:208605380-208605402 AGAACTCCTTGGACAAATGGTGG + Intronic
948572874 2:238928281-238928303 AGGAGCCCCTGGGAATGTGGAGG + Intergenic
1169199900 20:3703816-3703838 AGAACTCACTGAAGATGTGGAGG + Exonic
1171326302 20:24296523-24296545 TGAGCACCCTGGACATGTTGGGG + Intergenic
1175905124 20:62375798-62375820 CCAGCCCCCTGAACATGTGGGGG + Intergenic
1176046220 20:63094184-63094206 AGAGCCCCATGGGCATGGGGAGG + Intergenic
1176181863 20:63753211-63753233 AGACCCCACTGGGCATGTGTGGG + Intronic
1176980400 21:15375290-15375312 GGAAGCCCCTGTAGATGTGGAGG - Intergenic
1179995572 21:44972520-44972542 AGTCCCCCATGGACAGGTGGAGG - Intronic
1181409810 22:22710929-22710951 AGAAGCACCTGGAGATGGGGTGG + Intergenic
1184289821 22:43492668-43492690 AGAGCCCCTTGCACAGGTGGGGG - Intronic
1184601391 22:45545664-45545686 AGACCACACTGGACAGGTGGAGG + Intronic
1184827717 22:46964315-46964337 AGTACCTTCTGGGCATGTGGAGG + Intronic
1185000319 22:48241616-48241638 AGAACACCCAGAGCATGTGGGGG + Intergenic
949186579 3:1199266-1199288 AGAATCACCTGGACCTGAGGTGG - Intronic
949279442 3:2328832-2328854 AGAACCCCCTGCAGATGCTGGGG - Intronic
950533402 3:13566165-13566187 AGAAGCCCCTGGAGATGGGGTGG - Intronic
952825528 3:37521461-37521483 AGAGCCCTCTGGGCATATGGCGG + Intronic
953787713 3:45923156-45923178 CAAAGCCCCTGGCCATGTGGCGG - Intronic
953875361 3:46663589-46663611 AGAACTCTCTGGACATCAGGAGG - Intergenic
958937239 3:100269802-100269824 AGAAACCCCCAGAAATGTGGTGG + Intronic
960056615 3:113280276-113280298 TGATCTCCCTGGACATGTGAGGG - Intronic
961781064 3:129320287-129320309 AGAACCCTCTGGGTATGTGTGGG - Intergenic
969475510 4:7420478-7420500 AGCAGCCAGTGGACATGTGGGGG + Intronic
972354721 4:38269576-38269598 AGAACCCCCAGAAGATGTAGAGG + Intergenic
973333918 4:48936846-48936868 ATGGCCCCCTGGACAAGTGGTGG + Intergenic
977728014 4:100320402-100320424 AGAACCACATGGAATTGTGGAGG - Intergenic
978373524 4:108052026-108052048 GGAACCCCCAGGACATGAGCTGG - Intronic
979680505 4:123454298-123454320 AGAATCCCCAGAACATGGGGAGG - Intergenic
992749531 5:79849564-79849586 TGCAGCCCCTGGACAAGTGGCGG - Intergenic
994263383 5:97685962-97685984 AGAGTCCCCTGGACATTTTGTGG + Intergenic
997467564 5:134098580-134098602 TCAACCTCCTGGACAGGTGGTGG + Intergenic
998387158 5:141763979-141764001 AGCACCCCCAGGTCATGTTGTGG - Intergenic
998442655 5:142175331-142175353 AGAGCCCAGAGGACATGTGGAGG + Intergenic
1002761806 6:208316-208338 AATACCCCCTGGGCAGGTGGTGG + Intergenic
1002847009 6:955782-955804 AGAGCCCCCTGGCCCTGTGTTGG - Intergenic
1003112641 6:3262215-3262237 AGAACTCCCTGGGCATCTGCTGG + Intronic
1003321708 6:5057902-5057924 AGAATTAGCTGGACATGTGGTGG - Intergenic
1003586287 6:7391914-7391936 GGTTCCCCGTGGACATGTGGAGG - Intronic
1004293741 6:14391548-14391570 AGGACCCCGTGGGGATGTGGGGG - Intergenic
1007408546 6:41648614-41648636 AGGACCCTCTGTAAATGTGGGGG - Intronic
1009806463 6:68606753-68606775 ATAGCAGCCTGGACATGTGGTGG - Intergenic
1009813849 6:68705579-68705601 AGAACCAGATGGACATGTGAAGG + Intronic
1012889208 6:104879836-104879858 AGGACCACCTGAACATGGGGAGG - Intergenic
1013635207 6:112022613-112022635 AGAAGCAGCTGGAGATGTGGAGG - Intergenic
1015995668 6:138993458-138993480 AGAACCTCCTAGAGATTTGGAGG + Intergenic
1017728823 6:157296361-157296383 AGCACCCCCTGGAGGTGTGCAGG - Intronic
1018415802 6:163601168-163601190 AGAAGCCCATGAACATGAGGCGG - Intergenic
1019224453 6:170498703-170498725 AGACCCTCTTGGACATGTGGAGG + Intergenic
1022902210 7:34822097-34822119 AGAACTCCCTGGCCTTGTAGAGG + Intronic
1023547373 7:41332231-41332253 AGAACCCTCAGGAAATGTGAAGG + Intergenic
1024398659 7:48898175-48898197 AGAACACCATGGACATATAGAGG + Intergenic
1025562204 7:62381763-62381785 AGATCCCCCTGGAAATTAGGTGG + Intergenic
1029203414 7:98854251-98854273 AGAAACATCTGGACATGTGAAGG + Intronic
1029690083 7:102175500-102175522 AGAGGCGCCTGGACATGTGGTGG - Intronic
1031832620 7:126646077-126646099 AGAGGCCCCTGGGCATGTGGAGG - Intronic
1034579158 7:152027447-152027469 ACAACCCCCACGACATGAGGCGG + Intronic
1037127183 8:15365626-15365648 GGATCCCTCTGGACATGGGGTGG - Intergenic
1040324454 8:46334659-46334681 AGAATGCCCTGGACAGGTGGGGG - Intergenic
1040548235 8:48418762-48418784 AAAGCCCTCTGGACATGTGCAGG + Intergenic
1044392567 8:91669151-91669173 AGATCCTCCTGGGCGTGTGGAGG - Intergenic
1044993080 8:97813583-97813605 AGAATCCCCTGGATCTGTTGAGG + Intronic
1046628405 8:116599376-116599398 AGAACCACATGGACATATAGAGG - Intergenic
1047224543 8:122945229-122945251 AGAACCCTGTGGACAGCTGGGGG - Intronic
1049259135 8:141629466-141629488 AAAACTCCCTGGGCCTGTGGAGG + Intergenic
1049619052 8:143589592-143589614 AGATCCCCCAGGTCACGTGGTGG + Exonic
1055980476 9:81995376-81995398 CGAACCCCCTGGAGCTGTTGTGG + Intergenic
1056419595 9:86410620-86410642 AGAGACCCCTGGACCTGTGCTGG + Intergenic
1056705252 9:88946801-88946823 AGGAGCCCCTGGGCATGTGGTGG - Intergenic
1056764248 9:89435135-89435157 ACATCCCCCAGGGCATGTGGAGG + Intronic
1062723843 9:138059847-138059869 AGAACCCCCTGGACATGTGGAGG + Intronic
1197770859 X:130088385-130088407 AGAACACCCTGCACATCTTGGGG - Intronic
1198428251 X:136541125-136541147 AGAACCCCCTGAAAACCTGGAGG - Intronic
1200984975 Y:9294613-9294635 AGAACTCCCTGGAGGTGTGTTGG - Intergenic
1202125471 Y:21565575-21565597 AGAACTCCCTGGAGGTGTGTTGG + Intergenic
1202153537 Y:21863817-21863839 AGAACTCCCTGGAGGTGTGTTGG - Intergenic