ID: 1062724112

View in Genome Browser
Species Human (GRCh38)
Location 9:138061625-138061647
Sequence CATCAGCTTGGAGCACACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062724112_1062724118 28 Left 1062724112 9:138061625-138061647 CCTGCGTGTGCTCCAAGCTGATG 0: 1
1: 0
2: 2
3: 11
4: 82
Right 1062724118 9:138061676-138061698 CTGAGATGTTAGTGCCGGCACGG No data
1062724112_1062724117 23 Left 1062724112 9:138061625-138061647 CCTGCGTGTGCTCCAAGCTGATG 0: 1
1: 0
2: 2
3: 11
4: 82
Right 1062724117 9:138061671-138061693 AATCTCTGAGATGTTAGTGCCGG No data
1062724112_1062724115 -2 Left 1062724112 9:138061625-138061647 CCTGCGTGTGCTCCAAGCTGATG 0: 1
1: 0
2: 2
3: 11
4: 82
Right 1062724115 9:138061646-138061668 TGTTATATGGAATCCTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062724112 Original CRISPR CATCAGCTTGGAGCACACGC AGG (reversed) Intronic
900497522 1:2982795-2982817 AACCAGCCTGGGGCACACGCAGG + Intergenic
900603730 1:3514776-3514798 CATCAGCCTGGAGCACAGAGTGG - Intronic
903817549 1:26075787-26075809 CCTCTGCTTGGAGCACCCTCAGG + Intergenic
920170828 1:204071600-204071622 CATCACCTTTGAACACATGCTGG + Intergenic
921368023 1:214393234-214393256 CATGACCCAGGAGCACACGCAGG + Intronic
923434476 1:233955373-233955395 CACCAGATTGGGGCATACGCTGG - Intronic
1062926247 10:1317721-1317743 CATCAGCAGGGGGCACAGGCAGG + Intronic
1062946106 10:1463306-1463328 CATCAGCGAGGGCCACACGCAGG - Intronic
1069838343 10:71323611-71323633 CATCAGCTTGCAGAGCAGGCTGG + Intronic
1070640990 10:78169780-78169802 CTTCAGTATGGAGCACACCCTGG + Intergenic
1073343622 10:102765116-102765138 CATGAGCTTGGAGAACATGCAGG + Intronic
1076808090 10:132869345-132869367 CTTCAGCTCGGAGCACGCGTGGG + Exonic
1083643749 11:64160018-64160040 CGTCAGCTTGGAGGACAAGCTGG + Intronic
1084285188 11:68126589-68126611 CAGTAGCTTGGACCACAGGCAGG - Intergenic
1088902782 11:114131014-114131036 CATGATCTTGCAGCACACGAGGG + Intronic
1089784245 11:120896571-120896593 CATCAGCTGGGAGCTCTCGTGGG - Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1092911435 12:13148465-13148487 CCTCAGCTTGCAGCACATCCAGG + Intergenic
1103068430 12:117919427-117919449 CATCAGCTTTGAACACAACCCGG + Intronic
1106125778 13:26898977-26898999 CATTAGGTTGGAGCCCACGGTGG - Intergenic
1108259785 13:48645068-48645090 CACCAGCATGGAGCTCAGGCTGG + Intergenic
1112435636 13:99389746-99389768 CTTCTGCGTGGAGCTCACGCAGG - Intergenic
1117454537 14:55884202-55884224 AATCAGCCTGGAGCAAACTCAGG + Intergenic
1122374826 14:101250777-101250799 GACCACCTTGGAGCACACGAAGG + Intergenic
1122848346 14:104513056-104513078 CACATGCTCGGAGCACACGCTGG + Intronic
1202904517 14_GL000194v1_random:60498-60520 CATCAGGCTGGAGCCCATGCAGG + Intergenic
1127295423 15:57604728-57604750 CAGCAGCTTGGAGCAGCAGCCGG + Intronic
1129122379 15:73408381-73408403 CATCAGCTTGTAGGGCAGGCTGG + Intergenic
1134059820 16:11192391-11192413 CCTCTGCTTGGAGAACACCCTGG + Intergenic
1134117201 16:11557916-11557938 CATCAGACAGGAGCACACTCTGG - Intronic
1141628117 16:85272123-85272145 CATTAGCTGGGTGCACACGCAGG + Intergenic
1143054721 17:4154347-4154369 CATGTGCTTGGAGCACACGCTGG - Intronic
1143907952 17:10224917-10224939 CATCAGCTTTGATGACACCCAGG + Intergenic
1144221042 17:13100135-13100157 CAGCAGCTTGGAGCACAGGAGGG - Intergenic
1144250060 17:13407463-13407485 CATGAGCTTGGAGCAAAGGCAGG - Intergenic
1145227444 17:21142083-21142105 CATCAGCTGGGAGCATCGGCAGG + Intronic
1145296032 17:21593264-21593286 CAACAGCTTGGAGGAGAAGCTGG + Intergenic
1149971963 17:61227672-61227694 CATCAGGTTGGAGCACACTCGGG + Intronic
1150650747 17:67008514-67008536 CAGCAGCTTGGAGCACTGGCTGG + Intronic
1152271480 17:79327414-79327436 CATCATCTTGGAGAACACCAGGG - Intronic
1153854709 18:9135262-9135284 GAGCAGCTGGGAGCACAGGCAGG + Intergenic
1161000892 19:1910242-1910264 CATCTGCTTGCAACTCACGCAGG + Intronic
1162565838 19:11445576-11445598 GATCAGCCTGGACCCCACGCCGG - Intronic
1163105912 19:15123006-15123028 CAACAGCCTGGAGCGCACCCCGG + Exonic
1165830231 19:38727049-38727071 CATCAGCCAGGAGCAGATGCAGG + Exonic
927695000 2:25233710-25233732 GATCAGATAGGAGCACAAGCAGG - Exonic
929835690 2:45395567-45395589 CATTAGCTAGGAGCACAAGTTGG - Intronic
935079659 2:99780220-99780242 CGTCAGCTTGAAGCACAGACTGG - Intronic
935944148 2:108270662-108270684 CATCAGTTTGGAGCTTAGGCGGG - Intergenic
937783195 2:125863826-125863848 CATCAGCATGGAGCCCATGCAGG - Intergenic
938727324 2:134120251-134120273 CAGCAGCCGGGAGCACCCGCCGG - Exonic
946009835 2:216555540-216555562 AATCAGCTGGGAGCACAGCCAGG - Intronic
946243373 2:218370603-218370625 CAGCAGCTTGCAACACACGCAGG + Intergenic
948283691 2:236768329-236768351 CATCATCTAGGAGCTCACCCAGG - Intergenic
948737301 2:240017325-240017347 CACCAGCCTGTGGCACACGCAGG + Intronic
1169091311 20:2862875-2862897 GAACAGCATTGAGCACACGCAGG - Exonic
1170824084 20:19778637-19778659 TCTTAGCTTGGAGCAGACGCTGG + Intergenic
1171174276 20:23039759-23039781 CATCAGCCAGCAGCACACCCTGG + Intergenic
1175972747 20:62695123-62695145 CCTCAGCCTGGAGCTCACCCAGG - Intergenic
1178371663 21:32031986-32032008 CAGCAGCTTTGACCACATGCTGG - Intronic
1181021553 22:20106188-20106210 CATCAGCATCGAGGACTCGCGGG + Exonic
1182711347 22:32325253-32325275 CACCAGCTTGGAGCCCTCGAGGG - Intergenic
1184522740 22:45005162-45005184 CATGAGATTGCAGCACATGCAGG - Intronic
949605953 3:5653777-5653799 CATCATCTTGGAGCCCACCTTGG + Intergenic
962454270 3:135550710-135550732 CATCAGCTTTAAACACAAGCAGG - Intergenic
962676669 3:137763138-137763160 AATAAGCCTGGAACACACGCAGG + Intergenic
976060673 4:81124635-81124657 CATCAGCTTGCAGCACATGAGGG + Intronic
985063568 4:186101317-186101339 CATCAGCCTGGAGCACCCTTCGG + Intergenic
985159275 4:187027290-187027312 CAGCAGCTTGCAGCAAACTCAGG - Intergenic
987252916 5:16118826-16118848 CATCAGCTTGGAGTAGACTGAGG + Intronic
1007285728 6:40746161-40746183 CATCAGCATGGAGCATAATCTGG - Intergenic
1010116243 6:72316257-72316279 CCCCAGCTTGGAGCACAGGAGGG + Intronic
1012579713 6:100852061-100852083 GATCAGATTGGAGCAGACGAAGG + Intronic
1015217849 6:130770618-130770640 AATCAGCTGGGAGCACCGGCAGG + Intergenic
1015239916 6:131010790-131010812 CTTCAGCTTGGAGCAACCTCAGG + Intronic
1017143746 6:151215502-151215524 CCTCAGGTTGGAGCATATGCAGG + Intergenic
1021043428 7:15891642-15891664 CCAGAGCTTGGAGCACATGCAGG + Intergenic
1032056945 7:128691256-128691278 GATCAGCTTGGAGAACATGCAGG - Intergenic
1036508832 8:9381820-9381842 AGCCAGCTTGGTGCACACGCTGG + Intergenic
1037536317 8:19827803-19827825 CATCAGGTTGGGGCAGACTCAGG - Intronic
1039017746 8:33171155-33171177 CATCAGCATGGAACAAGCGCAGG - Intergenic
1040745843 8:50641405-50641427 CAACAGCTGGGAGCACGTGCAGG - Intronic
1049458398 8:142707281-142707303 CCACAGCTCGGAGCACACACGGG + Intergenic
1053467394 9:38318900-38318922 CCTCAGCTGAGAGCACACGAGGG - Intergenic
1057804494 9:98210733-98210755 CAGCAGCTCTGAGCACTCGCTGG + Exonic
1059541259 9:115132771-115132793 CATCATCTTGGAGCTCACCCGGG - Intergenic
1061475465 9:130862936-130862958 CATCACCATGAAGCACAAGCTGG + Exonic
1061665625 9:132159623-132159645 CATCAGCTTGTTGCAGAGGCAGG + Intergenic
1061755374 9:132808829-132808851 CAGCAGCCGGGAGCACAGGCAGG + Intronic
1061847237 9:133394579-133394601 CCTCAGCTTGCAGCACCTGCTGG + Intronic
1062724112 9:138061625-138061647 CATCAGCTTGGAGCACACGCAGG - Intronic
1203563031 Un_KI270744v1:73787-73809 CAGCAGGCTGGAGCCCACGCAGG - Intergenic
1186644227 X:11489410-11489432 CTTCAGCTTAGAGCACAGGTTGG + Intronic
1195753786 X:108181081-108181103 CAGCAGCTGGGAGCCCACACTGG + Intronic
1196771939 X:119303029-119303051 CATCAATTTGGAGCATATGCAGG - Intergenic
1200895837 Y:8375278-8375300 AATCAGCTTGGAGCACATATGGG + Intergenic