ID: 1062725050

View in Genome Browser
Species Human (GRCh38)
Location 9:138068136-138068158
Sequence CCTGTCCCTGGCCTTTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062725050_1062725053 8 Left 1062725050 9:138068136-138068158 CCACAACAAAGGCCAGGGACAGG 0: 1
1: 0
2: 2
3: 38
4: 263
Right 1062725053 9:138068167-138068189 GAATGCATTTCCAGAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062725050 Original CRISPR CCTGTCCCTGGCCTTTGTTG TGG (reversed) Intronic
901004634 1:6165861-6165883 CCTGTCCCTGTTATTTGATGGGG - Intronic
901647954 1:10726792-10726814 CCTCTCCCTGGCCTCTCTTCAGG - Intronic
902209088 1:14892042-14892064 CCTGCCTCTGGCCTCTGGTGTGG + Intronic
903886896 1:26545997-26546019 CCTGTCCCTGGCCCTGGCTCTGG + Exonic
904462802 1:30690401-30690423 CTTGGCTCTGGCCCTTGTTGTGG - Intergenic
909020071 1:70420610-70420632 CCTGTCTGTGGCCTGGGTTGGGG + Intronic
909078846 1:71085373-71085395 CCTGCACCTGGCCTTCCTTGAGG + Intergenic
909767467 1:79374544-79374566 CCTGTTACAGGGCTTTGTTGTGG - Intergenic
911693200 1:100858651-100858673 CCTGACCCTGGCCTTAATAGAGG - Intergenic
912184634 1:107260554-107260576 CCTGTCTCTGGCTTTTGGTCAGG + Intronic
913488020 1:119351616-119351638 CCTATCCCTGGCCTTGGTTAGGG + Intergenic
914904610 1:151733583-151733605 CCTGTTCCTGGTCTCTGTTGAGG - Intergenic
916886568 1:169074430-169074452 ACTGTACCTGGCCTTCATTGTGG - Intergenic
918380145 1:183945610-183945632 TCTTTCTCTGGCCTTTGTGGTGG - Intronic
919283925 1:195528429-195528451 CCAATCCCTGGTCTTTTTTGAGG - Intergenic
920413733 1:205783472-205783494 TCTTTCCCTGGCCTTTATTTGGG - Intergenic
920422516 1:205844767-205844789 CCTATCTCTGTCCTCTGTTGAGG - Intronic
920506166 1:206517009-206517031 GCTGCCCATGGCCTTTGTTGTGG - Intronic
921690840 1:218147850-218147872 CATGACCCTGGCTTTTGGTGAGG + Intergenic
922306111 1:224345961-224345983 ACTGTGCCTGGCCTCTTTTGGGG + Intergenic
923030918 1:230248512-230248534 CCTGTACCCGGACTTGGTTGTGG - Intronic
923267485 1:232328622-232328644 CATTTCCCAGGCCTTTGGTGCGG - Intergenic
1063271007 10:4509886-4509908 CCTGTCCCTGGCCTTGAGTGGGG - Intergenic
1066612398 10:37263770-37263792 CCAGTCCATGGCCTGTGTCGTGG + Intronic
1068814505 10:61294431-61294453 CCTGTCCTTGGGCTGTGTGGAGG - Intergenic
1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG + Intergenic
1070410380 10:76134021-76134043 TCTGTTCCTGGACTTTGTTGGGG - Intronic
1071501127 10:86204963-86204985 TCAGTCCCTGGCCCTTGGTGAGG - Intronic
1071756102 10:88541951-88541973 CATGTCCTTGGCCTGTGCTGTGG - Intronic
1073322075 10:102621519-102621541 TCTGTCCCTGACCTGGGTTGGGG + Intronic
1074399923 10:113133537-113133559 CAAGTCCTTGGCCTTTCTTGGGG - Intronic
1076012807 10:127003963-127003985 ACTGTACCTGGCCTTTTTTTTGG - Intronic
1076401112 10:130186103-130186125 ACTTTCCCTGGCCTTTGTGTAGG - Intergenic
1076674266 10:132140198-132140220 CCTGGCCCTGCCCTTGGTGGTGG - Intronic
1077055899 11:592975-592997 CCTGGTCCCGGCCTTTGTGGGGG + Intronic
1077108280 11:851194-851216 CCTGTCCCTGGCTCCTGTGGAGG + Intronic
1077517801 11:3012352-3012374 CCAGTCCCTGCCCTGTGTCGCGG - Intronic
1077518023 11:3013900-3013922 CCAGTCCCTGCCCTGTGTCGTGG - Intronic
1079689749 11:23405045-23405067 CCTGGCCCCGGCCTTGGCTGAGG + Intergenic
1081018673 11:37915365-37915387 CCTGGGTCTGGCCTTTGTTCTGG + Intergenic
1081461319 11:43275273-43275295 CCTGCCTTTGGGCTTTGTTGCGG - Intergenic
1083681962 11:64355390-64355412 CTTGTCCCTCACCTTTGCTGTGG - Exonic
1083850944 11:65366542-65366564 CCTGCCCCTTTCCTTTGTGGTGG - Intergenic
1083944390 11:65915978-65916000 CCTGGCCCTGGCCTTGATTGGGG - Intergenic
1085254907 11:75166941-75166963 CCTATCCCTGGCCTCTGGTCTGG - Intronic
1085694444 11:78692042-78692064 CAGGTCCCTGCTCTTTGTTGTGG - Intronic
1087183464 11:95161361-95161383 CCAGTCTCTGGCCTTTGTGTTGG + Intergenic
1087736583 11:101840985-101841007 CGGGTCCTTGGCCTTTTTTGGGG + Intronic
1089167109 11:116485791-116485813 CTTGTCCCTAGGTTTTGTTGTGG + Intergenic
1089301247 11:117500056-117500078 CCTGTGACTGTCCTATGTTGAGG - Intronic
1089360545 11:117883263-117883285 GCTGTGCCTGGCCTTTCTTGGGG + Intergenic
1089497181 11:118913735-118913757 CCTGGCCCTTGCCTCTGTTGGGG - Intronic
1091908475 12:4208994-4209016 CCTCTCCCTGGCCTTCCTGGCGG - Intergenic
1092674437 12:10900557-10900579 CCTGCCCCAGGCCTGTGATGGGG - Intronic
1093772059 12:23029721-23029743 CCTCTCCCTGGCATCTGGTGGGG + Intergenic
1096386172 12:51196798-51196820 CCTGTCCCTGAGCATTGGTGAGG + Exonic
1096715132 12:53486663-53486685 CCTGTCCCTGGCCTTGAGTGTGG - Intronic
1097537113 12:60886125-60886147 TCTGGCCCTGGACTTTTTTGGGG + Intergenic
1098222717 12:68286939-68286961 CTTTTCCTTGGCCTTTGTAGGGG - Intronic
1098608732 12:72427523-72427545 TGTATCCCTGGCTTTTGTTGGGG + Intronic
1099212219 12:79805597-79805619 TCTCTCCCTGACCTCTGTTGTGG + Exonic
1100599348 12:96099563-96099585 CCAGTCCATGGTCTTTGTTATGG - Intergenic
1102045654 12:109828561-109828583 TCTGTTCCTGGGCTTTGCTGAGG - Intronic
1103350372 12:120279250-120279272 CCTTACCCTGGTATTTGTTGAGG + Intergenic
1104662398 12:130620610-130620632 CCTGTCCCCGGCTTCTGTGGTGG + Intronic
1113362230 13:109642150-109642172 CCTGTCTCTGACTTTGGTTGGGG + Intergenic
1115399855 14:32943977-32943999 ACTGTGCCTGGCCTTTATTTGGG + Intronic
1117131089 14:52687528-52687550 CCTGTCTTTGGTCTTAGTTGAGG - Intronic
1118247050 14:64121229-64121251 ACTGTGCCTGGCCTTTTTTTTGG - Intronic
1118316083 14:64726960-64726982 CCTGTCTGTGGCCTGTGCTGGGG - Intronic
1119421754 14:74511439-74511461 CTTGTCCCTGCCTTTGGTTGGGG + Intronic
1119704945 14:76777660-76777682 CGTTTACCTGGCCTTTGTTGGGG + Intronic
1119781188 14:77277816-77277838 CCAGTCCCTGGCCTTGGTGCTGG - Intronic
1121345957 14:93136077-93136099 CCTGTCTCTGGCTGTTGTTCAGG + Intergenic
1121571050 14:94946826-94946848 TCTGGCCAAGGCCTTTGTTGTGG - Intergenic
1121586245 14:95064870-95064892 CCTTTGCCTGGCCCTGGTTGAGG - Intergenic
1122279567 14:100613357-100613379 CCTGCCCCTGGCCTGTACTGGGG - Intergenic
1122850889 14:104530125-104530147 CTTGTCCCCAGCCTTTGCTGTGG - Intronic
1122944364 14:104999327-104999349 CATGTCCCTGGCCTCTGATGTGG - Intronic
1124614874 15:31234295-31234317 CCTGTCAGTGGCCCTTGCTGAGG + Intergenic
1124971028 15:34489849-34489871 GCTGCCTCTGGCGTTTGTTGGGG + Intergenic
1125471712 15:40010932-40010954 CCAGAGCCTGGCCTTTGTTAGGG + Intronic
1125741246 15:41966351-41966373 TCTCTCCCTGGCTTTTGTGGGGG + Intronic
1127318548 15:57819677-57819699 ACTGTGCCTGGCCTTTGCTTGGG + Intergenic
1127704535 15:61533957-61533979 CCTTACCCTGACCCTTGTTGTGG + Intergenic
1129132800 15:73515826-73515848 CCTGTCTCTGGTATTTGTTATGG + Intronic
1129710373 15:77817732-77817754 GCTGACCCTGGTCTTTGGTGAGG - Intronic
1129771564 15:78206378-78206400 CCTGTCCCTGCCCTTTACAGAGG + Intronic
1130390399 15:83448961-83448983 CATGTCACTGGCCTGGGTTGGGG + Intronic
1130770304 15:86917288-86917310 CCTGTCCCTGGCCTCTGCCTGGG + Intronic
1131091385 15:89627251-89627273 CCTGGCCCTGCCCCTTGTTGGGG + Exonic
1131929187 15:97419841-97419863 CCTGTCCCTGACCTTGAGTGTGG - Intergenic
1131962648 15:97805822-97805844 CCTATCCTTGGCCTTTCTTGGGG - Intergenic
1132139818 15:99383179-99383201 CCTGTCTCTGGCCTTTGGCTTGG + Intronic
1132640376 16:975542-975564 CCTTTCCCCTGCCTTTCTTGGGG - Intronic
1133596286 16:7296689-7296711 CCTGTCCCTGGCCATGGATGTGG + Intronic
1134470720 16:14522794-14522816 CCTGTCCATGGCCTGGGGTGGGG + Intronic
1135489880 16:22900074-22900096 CAGGTCCCTGGCCCTTTTTGAGG + Intronic
1135508429 16:23059629-23059651 CCTGTGCCTTCCCTTTGTTTAGG - Intergenic
1136403925 16:30032368-30032390 CCAGTCCCTGGCCTTTCTTTGGG - Intronic
1136869750 16:33795678-33795700 CCTTTGCCAGGCCTTTATTGTGG + Intergenic
1138205522 16:55121661-55121683 CCCCTCCCTGGCCTTAGTTCTGG - Intergenic
1139333095 16:66209383-66209405 CCTCTCCCTCTCCTTTGGTGGGG + Intergenic
1139516292 16:67454238-67454260 CTTGCCCCTGCCCTTTGCTGTGG - Intronic
1140181872 16:72728653-72728675 CCGGTCCCTGGGCTTTGTCCAGG + Intergenic
1141155190 16:81592480-81592502 CCTGTCCTTGCCCTTTGTACCGG + Intronic
1141818872 16:86431600-86431622 CATGCCCCTGGCCTTCCTTGGGG - Intergenic
1141999551 16:87656381-87656403 CCAGTCCATGGCATTTGTTGGGG + Intronic
1203102422 16_KI270728v1_random:1320377-1320399 CCTTTGCCAGGCCTTTATTGTGG - Intergenic
1142640751 17:1284511-1284533 CCTGTCCCTGGCCCTGGTCCTGG - Intronic
1143121377 17:4609362-4609384 CTTGTCTGTGGTCTTTGTTGGGG + Intergenic
1143543982 17:7585751-7585773 CCAGCCCCAGGCCTTTGCTGAGG - Exonic
1143744438 17:8981176-8981198 ACTGCCCCTGGCCTCTTTTGAGG - Intergenic
1145144019 17:20466382-20466404 CCCGACCCTGGCCTCTGCTGAGG + Intronic
1145366685 17:22271371-22271393 CCTGACACTGGACTTTGTTGGGG - Intergenic
1145791847 17:27632325-27632347 CCCGACCCTGGCCTCTGCTGAGG - Intronic
1146055053 17:29576805-29576827 CCTGACCCAGGCCTTCGCTGAGG - Intronic
1146312588 17:31780557-31780579 TATGTCCCTGGTCTTTGGTGGGG - Intergenic
1147121824 17:38339579-38339601 TGTGTCCCTGGGCGTTGTTGGGG + Intronic
1147877158 17:43629768-43629790 CCTTTCCCTTGCCTTTACTGGGG - Intergenic
1148156449 17:45427585-45427607 CCCTACCCTGGACTTTGTTGGGG + Intronic
1148325708 17:46782386-46782408 CCTGGCCCTGGCCTGTTGTGGGG - Intronic
1149421009 17:56510939-56510961 CCTGTCCCAGGCCTGTGGTCTGG + Intronic
1149504366 17:57181721-57181743 ACTGTGGCTGGCCTTTGTTTAGG + Intergenic
1149645231 17:58236010-58236032 GCTGTCCCTGGCCTCTGGAGGGG - Intronic
1150047162 17:61925289-61925311 ACTGTGCCTGGCCTATGTGGTGG - Intronic
1150388123 17:64776216-64776238 CCCTACCCTGGACTTTGTTGGGG + Intergenic
1150630103 17:66874433-66874455 CATATCCCTGGCCTGTGATGAGG + Intronic
1151656578 17:75499026-75499048 CCTGTCCCTGGTCCTTGTGGTGG + Exonic
1152439622 17:80298087-80298109 CCTGTCCTGGGAGTTTGTTGTGG + Intronic
1153397405 18:4640408-4640430 CCTGCCAATGGCCTTTTTTGGGG - Intergenic
1155115142 18:22757813-22757835 ACTGTGCCTGGCCTTTTTGGTGG - Intergenic
1156084291 18:33380221-33380243 CCTGCCCCCGGCCTGTGATGAGG + Intronic
1156675175 18:39519475-39519497 ACTTTACCTGGCCTTTTTTGTGG + Intergenic
1157448576 18:47767653-47767675 CATGTCCCTGGCTTCTGGTGAGG + Intergenic
1160992985 19:1868239-1868261 CCTGTCCCTGCCCTGTTCTGCGG - Intergenic
1161309267 19:3585301-3585323 CCTGTCCCTGTCCTTATTTGTGG + Intergenic
1161533717 19:4805749-4805771 CCTGTCCGTGGGCTTTATTGTGG - Intergenic
1161615780 19:5269470-5269492 CCAGTCCCTGGCAGTTGGTGGGG - Intronic
1162741433 19:12775760-12775782 CCTCGCCCTGGCCCTTTTTGGGG + Intronic
1165156878 19:33794618-33794640 CCCGCCCCAGGCCTTTGTGGAGG - Intergenic
1165376132 19:35443701-35443723 ACCGTACCCGGCCTTTGTTGTGG - Intergenic
1165849413 19:38840521-38840543 GCTGCCTCTGGCGTTTGTTGGGG + Exonic
1166196049 19:41206535-41206557 CCTGTCCATGCCCACTGTTGAGG - Exonic
1166270486 19:41710443-41710465 CCTGTGCCAGGGCTGTGTTGTGG + Intronic
1166901943 19:46071282-46071304 CCTCTCCCTTGACTATGTTGGGG + Intronic
1167720024 19:51172890-51172912 CCTGACCCTGGTCATTCTTGCGG + Intergenic
1167868054 19:52344273-52344295 CCTTCCCCAGGCCTTTGTTCTGG + Intronic
925635413 2:5937389-5937411 CCTGTCCCTGGCCTCAGTCTAGG - Intergenic
925992903 2:9268292-9268314 CCTGTCCATGTCTTCTGTTGTGG + Intronic
927922503 2:26983943-26983965 CCCGTCCCTTCCCCTTGTTGGGG + Intronic
929419386 2:41775509-41775531 TCTCACGCTGGCCTTTGTTGGGG + Intergenic
934575176 2:95395706-95395728 CATGTCCATTGCCTTTATTGCGG - Intergenic
934956067 2:98620969-98620991 CATGTACCTGGACCTTGTTGGGG - Exonic
935190846 2:100777684-100777706 CCCTTCCCTGGCCCCTGTTGCGG - Intergenic
935602126 2:104933505-104933527 ACTGTCCCTGGACTTTATTAGGG - Intergenic
939690922 2:145259176-145259198 CCTCTCCTAGGCCTTTGTTTGGG + Intergenic
940300947 2:152175903-152175925 CCTGTCCCAGACTTTTGTAGGGG + Exonic
941274404 2:163472463-163472485 GCTGTCACTGGCCTTTGTGAAGG + Intergenic
945075014 2:206030134-206030156 CCTTACCCTGACCTCTGTTGTGG - Intronic
945428363 2:209735839-209735861 TCTGTCCCAGGCCTCAGTTGAGG + Intergenic
945725613 2:213469748-213469770 ACTGTTCCTTACCTTTGTTGTGG + Intronic
946056986 2:216911252-216911274 CCTGTCCCTGCCCTTCCTTCTGG + Intergenic
946951179 2:224877057-224877079 CCTGTCTCAGGCCTTCCTTGTGG - Intronic
947265422 2:228274335-228274357 CCTGTGCCTGGCCTTGGCTCTGG + Intergenic
947901753 2:233727169-233727191 TCTGTCTCTGGACTTTGCTGGGG + Intronic
948214218 2:236216621-236216643 AGTGTCACTGTCCTTTGTTGAGG + Intronic
948526112 2:238571788-238571810 CCTGCTCCTGGGCTGTGTTGCGG + Intergenic
948861595 2:240755195-240755217 GCTGACCCTGGCCTTGGGTGAGG + Intronic
948869690 2:240791858-240791880 CCCCTCCCAGGCCTGTGTTGTGG + Intronic
1168841404 20:912288-912310 CCTACCCCTGACCTTTGATGTGG - Intronic
1172631631 20:36382365-36382387 ACTGTGCCTGGCCTTTTTTAGGG + Intronic
1175646618 20:60679618-60679640 CCTTTCCCTGCCCTCTGTGGAGG - Intergenic
1176029752 20:63006204-63006226 CCAGGCCCTGGCCCTGGTTGAGG + Exonic
1176168824 20:63688058-63688080 CCTGTCCCTGGGCCCTGCTGGGG + Intronic
1176946523 21:14989067-14989089 CCTGTACCTGAGCTTTGTTGAGG + Intronic
1179351654 21:40617090-40617112 TCTGTGCCTGGCCTTTGTTCTGG - Intronic
1179534562 21:42043150-42043172 CTTGTCCTTGGCCCTTGGTGGGG - Intergenic
1180037359 21:45256694-45256716 CCTGGGCCTGGCCTGTGCTGCGG + Intergenic
1180160384 21:45996552-45996574 CCTGTCCCTGGCCTGTGGTTAGG - Intronic
1180676428 22:17589612-17589634 CCTCGCCCAGGCCTTTCTTGAGG - Exonic
1181266938 22:21635951-21635973 CCAGTCCCTGGACTTTGCTGAGG + Intronic
1182150718 22:28025371-28025393 CCTGGCTCTGCCCTTTGTTAAGG - Intronic
1183250070 22:36724200-36724222 ACTGTGCCTGGCCTTTTTTGTGG - Intergenic
1183860956 22:40669550-40669572 CCTGTACCTGGACTTTGTTGGGG + Intergenic
1183975137 22:41507682-41507704 CCTGTCCCTGGCCACTGTTGAGG + Intronic
1184066681 22:42125495-42125517 GCAGTCCCTGCCCTTGGTTGGGG + Intergenic
1184069149 22:42137647-42137669 GCAGTCCCTGCCCTTGGTTGGGG + Intergenic
1184863329 22:47189192-47189214 CCTGTCCCTGGACTCTGAGGTGG - Intergenic
1185071625 22:48659726-48659748 TCCGTCCCTGGCCTTTTTGGTGG + Intronic
949987424 3:9552226-9552248 CCCGTCCCTGGCGCTTGTTCTGG + Intronic
950026907 3:9826441-9826463 ACTGTACCTGGCCAGTGTTGGGG - Intronic
950269739 3:11604443-11604465 CCTGTCCCTGACCTTATGTGCGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950461013 3:13122273-13122295 CCTGTCCCGGGCCTTTGCAGGGG - Intergenic
952377280 3:32778305-32778327 ACCGTGCCTGGCCTTTGCTGGGG + Intergenic
952815658 3:37445227-37445249 TCTGGCCCTGGCCTCTGTTGAGG - Intergenic
953004800 3:38968338-38968360 CATCTCTCTGGCCTCTGTTGAGG - Intergenic
953580238 3:44147241-44147263 CCTGAGCATGGACTTTGTTGGGG - Intergenic
953946523 3:47153456-47153478 CCTGTGCCTGGCCTTAAGTGGGG - Intronic
954117041 3:48472728-48472750 TCTGTCCCTGGGCTGTGCTGTGG - Intronic
954305110 3:49721532-49721554 CCTGGCCCTGGCCCTTCTTGAGG + Exonic
954659426 3:52219047-52219069 CCTGTCCCTGCCCCTGATTGTGG + Intergenic
956074965 3:65495513-65495535 CCAGTGCCTGGCATGTGTTGGGG - Intronic
962422401 3:135240077-135240099 CCTGACCCTTCCCTGTGTTGGGG + Intronic
962944755 3:140157025-140157047 CTTGCCCCTGCCCTTTGTAGAGG + Intronic
964819918 3:160757349-160757371 GATGTCCCTGGCCTTTGCAGAGG + Intronic
965157852 3:165087623-165087645 CCTTTGCTAGGCCTTTGTTGTGG - Intergenic
971193266 4:24447664-24447686 CCTGTCCTTTGCTTTTGTTCAGG - Intergenic
973870503 4:55161287-55161309 CCTACCCCTTGCCTTTGGTGGGG - Intergenic
975330064 4:73102250-73102272 ACTGTGCCTGGCCTATGTTAAGG + Intronic
975648475 4:76568616-76568638 CCTGTCCCCAGCCCTTGTTCGGG + Intronic
976970370 4:91095374-91095396 CCTTTCCCTGCCCTTTGGGGGGG + Intronic
980306125 4:131063958-131063980 CCTTTGCCTGGCTTTTGTTCTGG + Intergenic
980416620 4:132496695-132496717 CCTTTCCCTGGCATTGGCTGCGG + Intergenic
982735072 4:158997592-158997614 CCTCTCCCTTGCCTTTTGTGAGG - Intronic
984793470 4:183635592-183635614 CCTGCCTGTGGCCTTTGTTCTGG - Intergenic
984808403 4:183772353-183772375 CCTGTCCCTGGTCTGTCTGGTGG + Intergenic
985749685 5:1667195-1667217 TCTGTCCCAGGCCTGGGTTGGGG - Intergenic
988591385 5:32552950-32552972 CCTGTCACTGGCACTTGCTGCGG + Intronic
993980324 5:94537164-94537186 CCTATCCCTGGCCATTGTGGGGG - Intronic
998175559 5:139899787-139899809 CCTCTCCCTGGTTTTTGTTGAGG + Intronic
998201280 5:140124973-140124995 TTTGTCCCTGGCCTTTTTCGAGG + Exonic
998894692 5:146787147-146787169 CCTTGCCATGGCCTTTGTTGAGG + Intronic
999622588 5:153487918-153487940 CCTGCCCCCAGCCTTTGCTGGGG + Intergenic
1002003284 5:176211219-176211241 TCTGGCCCTGGGCTTTTTTGTGG + Intergenic
1002223168 5:177699725-177699747 TCTGGCCCTGGGCTTTTTTGTGG - Intergenic
1002408534 5:179055010-179055032 CCTTTCCCTGCCCTTTGTGGGGG + Intergenic
1003579261 6:7324824-7324846 CCTGTCCCTAGGCTGTGCTGTGG + Intronic
1003596925 6:7481945-7481967 GCTGCCTCTGGCGTTTGTTGGGG + Intergenic
1006181120 6:32154033-32154055 CCTGTCCTGGGTCTGTGTTGCGG + Intronic
1006794650 6:36723979-36724001 CCTGCCCCAGGCCTCTCTTGTGG - Intronic
1006800485 6:36756635-36756657 CCTGTCCCTTGTGTTGGTTGAGG + Intronic
1007202371 6:40120860-40120882 CCTGTCCCTGGGCTCTGAAGTGG - Intergenic
1007866869 6:44980979-44981001 CCTGTCACTTGCCTTCCTTGAGG - Intronic
1010011367 6:71051549-71051571 ACTGTCACTATCCTTTGTTGGGG - Intergenic
1011205614 6:84892834-84892856 CATGTCCTGGGCATTTGTTGTGG + Intergenic
1014367228 6:120559784-120559806 TCTGGTCCTGGCCTTTTTTGGGG + Intergenic
1015121445 6:129705445-129705467 CCTATACCAGGCCTTTCTTGGGG - Intronic
1015863111 6:137701166-137701188 CCTGTCCCAGGTCCTTGATGTGG - Intergenic
1017443350 6:154484942-154484964 CCTGTCTCAGGCCTTTGGAGAGG + Intronic
1018733338 6:166669456-166669478 CCTCACCCTCGCCTCTGTTGGGG + Intronic
1021937911 7:25649290-25649312 CTTGTCTGTGGCCTTTGTGGGGG - Intergenic
1022974654 7:35546096-35546118 CCTGTTTCTGGCTTTTGATGGGG - Intergenic
1023896467 7:44437564-44437586 CCTGACTCTGGCCTGTGTGGGGG + Intronic
1024669621 7:51582492-51582514 TCTGTCTCCAGCCTTTGTTGTGG + Intergenic
1024949839 7:54848949-54848971 TTTGTCGCTGGCATTTGTTGGGG + Intergenic
1025618539 7:63146164-63146186 ACTGTGCCCGGCCTTTATTGTGG - Intergenic
1026595438 7:71730801-71730823 ACTGTGCCTGGCCTCTCTTGGGG - Intergenic
1026911222 7:74093022-74093044 CCTTTGCCTGGGCTTTGGTGCGG - Intronic
1026911886 7:74095803-74095825 TCTAACCCTGGCCTGTGTTGTGG + Intronic
1027698057 7:81435822-81435844 CTTGGCCTTGGCCTTTGGTGTGG - Intergenic
1028603077 7:92623908-92623930 CCTGTTTATGGCATTTGTTGAGG - Intronic
1029150624 7:98477808-98477830 CCTGTCCCTGTTTTTTGTTTTGG - Intergenic
1029371439 7:100153525-100153547 CCTGCCCCTGCCCTTGGTGGTGG + Intronic
1031789185 7:126078776-126078798 TCTGTCCCTTACCTTTGGTGTGG + Intergenic
1032804057 7:135338648-135338670 CCTGTCTCTGGCCTTGGCTGGGG + Intergenic
1033080442 7:138291778-138291800 CATGTGCCTGGCCTGTTTTGAGG - Intergenic
1034770544 7:153770514-153770536 CTTCTCCTTGGCCTTTCTTGTGG - Intergenic
1035213944 7:157350515-157350537 CCGGTCACTGGCGTTTGTTCAGG + Intronic
1036024027 8:4882533-4882555 TCTGTCCGTGGCCTCTGCTGAGG + Intronic
1036693637 8:10960590-10960612 CCTGTGGCTGGGCTGTGTTGAGG - Intronic
1037591172 8:20313291-20313313 CCTGACCCTGAGTTTTGTTGCGG + Intergenic
1038222564 8:25624607-25624629 CATGGCCCTGGCTTTTGTTAAGG - Intergenic
1045111465 8:98941726-98941748 CCTGTCCCTGGCCTTCATCCCGG + Intronic
1045528216 8:102959701-102959723 GCTGTCCCTGGCCTGTGTCTAGG - Intronic
1047673307 8:127172268-127172290 GCTCTCTCTGGCCTCTGTTGAGG + Intergenic
1048963934 8:139601565-139601587 GCTGTCCCCGTCCTCTGTTGGGG + Intronic
1049075470 8:140392615-140392637 CGAGTGCCTGGCCTTTGGTGTGG + Intronic
1049309436 8:141925509-141925531 CCTGTCACTGGCCTGTGTCAAGG - Intergenic
1049330010 8:142045463-142045485 CCTGTCCCTGGCTTTGGTCATGG + Intergenic
1049418679 8:142507231-142507253 CCTGTCCCTGGGCTGTGTGTTGG + Intronic
1049607450 8:143536317-143536339 CCTGTACCAGGCCCTTGTTGGGG + Exonic
1049848734 8:144819477-144819499 CCTGCCCCAGGCCACTGTTGGGG + Intergenic
1050514653 9:6430297-6430319 CCTGTGCCTGGCCCTTAATGTGG + Intronic
1052313035 9:27088910-27088932 CAAGTGCCTGGCCTGTGTTGTGG + Intergenic
1055382954 9:75729122-75729144 CCTGTCACTGGCCTTCCTTGTGG + Intergenic
1056292775 9:85160547-85160569 CCTGAGGCTGGCCTTTGGTGAGG + Intergenic
1056720590 9:89068210-89068232 CCTGTGCCTGGCCATTGTTCTGG + Intronic
1060671209 9:125471382-125471404 CCTGCCCCTGGCCTGGGCTGTGG - Intronic
1060881701 9:127122381-127122403 CCTGTCCATGGCCTCTGGAGGGG + Exonic
1061199542 9:129129120-129129142 CCAGTCCCTGGCCTGTCCTGTGG - Intronic
1061497137 9:130981560-130981582 GCTGTCCCTGGCCTGGGATGGGG + Intergenic
1062089409 9:134667277-134667299 CCTGTCCCTAGCCTATCTGGTGG + Intronic
1062105784 9:134754096-134754118 TCTGTCCCTGGCCTTCATTCTGG + Intronic
1062140616 9:134955983-134956005 CCTCCCCTTGGCCTTTGCTGTGG + Intergenic
1062630666 9:137461737-137461759 CCGGTCCCTGCCCTTACTTGGGG - Intronic
1062725050 9:138068136-138068158 CCTGTCCCTGGCCTTTGTTGTGG - Intronic
1187962122 X:24576592-24576614 ACTGTGCCTGGCCTGTGTTTCGG + Intronic
1188780649 X:34279899-34279921 CCTGTCCCTTCCCTGTGTTTTGG + Intergenic
1190814748 X:53920037-53920059 ACCGTGCCTGGCCCTTGTTGAGG + Intergenic
1191788369 X:64942013-64942035 CCTGGCCCTGGACTTTTTTTTGG + Intronic
1192964936 X:76167236-76167258 CCTGTCCCCGGACTGTTTTGTGG - Intergenic
1192996417 X:76517334-76517356 ACTCTCCCTTGCCTCTGTTGTGG - Intergenic
1196367996 X:114944599-114944621 CCTTTCTCTTGCCCTTGTTGGGG - Intergenic
1196942893 X:120795226-120795248 CCTTTCCCTACCCTTTGTTAGGG + Intergenic
1197251155 X:124217687-124217709 CCTGTCCCTGCCCTTTGGTTTGG - Intronic
1197782466 X:130171802-130171824 CCTCTCCCTGGCTTTTGTGTTGG + Exonic
1198969716 X:142267565-142267587 CCTTTCCCTGCCCTTTGGGGGGG - Intergenic
1198969798 X:142268026-142268048 ACTGCCCCTTGCCTTTGTTAGGG + Intergenic
1200119003 X:153781657-153781679 CCTGTCCCTGGGCTTGCTTGGGG + Intronic
1200986025 Y:9304113-9304135 CCTGTCTCTGTCCAGTGTTGGGG - Intergenic
1202124560 Y:21556788-21556810 CCTGTCTCTGTCCAGTGTTGGGG + Intergenic
1202154448 Y:21872592-21872614 CCTGTCTCTGTCCAGTGTTGGGG - Intergenic