ID: 1062725985

View in Genome Browser
Species Human (GRCh38)
Location 9:138073846-138073868
Sequence CTGGGGCATCACTTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 0, 2: 7, 3: 75, 4: 741}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062725977_1062725985 18 Left 1062725977 9:138073805-138073827 CCTGAGGTGGGTTTCATGACTCC 0: 1
1: 0
2: 0
3: 2
4: 142
Right 1062725985 9:138073846-138073868 CTGGGGCATCACTTGGTGGAGGG 0: 1
1: 0
2: 7
3: 75
4: 741
1062725976_1062725985 19 Left 1062725976 9:138073804-138073826 CCCTGAGGTGGGTTTCATGACTC 0: 1
1: 0
2: 0
3: 19
4: 255
Right 1062725985 9:138073846-138073868 CTGGGGCATCACTTGGTGGAGGG 0: 1
1: 0
2: 7
3: 75
4: 741
1062725978_1062725985 -3 Left 1062725978 9:138073826-138073848 CCGAGTTAGAGATAAAGAAACTG 0: 1
1: 0
2: 35
3: 374
4: 2439
Right 1062725985 9:138073846-138073868 CTGGGGCATCACTTGGTGGAGGG 0: 1
1: 0
2: 7
3: 75
4: 741

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062725985 Original CRISPR CTGGGGCATCACTTGGTGGA GGG Intronic
900161492 1:1226234-1226256 CTGGAGCATCTCGTGGTGCAGGG + Intronic
900271522 1:1792033-1792055 CTGAGGCATGATTTGGTGGCAGG - Intronic
900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG + Intronic
900746779 1:4366056-4366078 CTGCGGCCTCGCGTGGTGGATGG - Intergenic
901046790 1:6401336-6401358 CTGGGGGATCACCTGGGGGTCGG + Intergenic
901482895 1:9538341-9538363 CTTGGGCATTACTAGGTGGCAGG + Intergenic
901558766 1:10052939-10052961 CTGTGTCCTCACTTGGAGGAAGG + Intronic
903385499 1:22923648-22923670 CTGTGTCTTCACTTGGTGGAAGG - Intergenic
903592758 1:24469686-24469708 CTGGGCCAACCCTGGGTGGAAGG + Intronic
903663962 1:24995626-24995648 ATGAGCCATCACTTGGGGGATGG - Intergenic
903666492 1:25010872-25010894 CTGTGTCTTCACTTGGTGGAAGG - Intergenic
904304666 1:29580395-29580417 CTGGGGCCTTCCTTGCTGGAAGG + Intergenic
904312548 1:29638474-29638496 CTTGGGCATCTCTTGCAGGAGGG - Intergenic
904324708 1:29720862-29720884 CTGTGTCTTCACTTGGTGGAAGG + Intergenic
904869877 1:33610005-33610027 CTGCGTCCTCACATGGTGGAAGG - Intronic
905350178 1:37340117-37340139 CTGTGTCTTCACATGGTGGAAGG - Intergenic
905854692 1:41301603-41301625 TTGTGTCATCACGTGGTGGAAGG - Intergenic
905991590 1:42341997-42342019 CTGGGGCATGACATGGTCCATGG - Intergenic
906730042 1:48072932-48072954 CTGCGTCCTCACATGGTGGAAGG - Intergenic
907026272 1:51123101-51123123 ATAGGGCATCACATGGTGAAGGG + Intronic
907287222 1:53389677-53389699 CTGTGTCTTCATTTGGTGGAAGG + Intergenic
907709468 1:56865397-56865419 CTGTGTCCTCACGTGGTGGAAGG + Intronic
907810600 1:57865983-57866005 CTGTGTCCTCACATGGTGGAGGG + Intronic
908040193 1:60104496-60104518 CTGTGGCATCACATGATAGAAGG - Intergenic
908089597 1:60671819-60671841 CTGTGTCTTCACATGGTGGAAGG - Intergenic
908107975 1:60865445-60865467 CTCGGCCAGAACTTGGTGGATGG + Intronic
908500287 1:64736611-64736633 CTGGGACATCACTAGGTGGTAGG - Intergenic
908554632 1:65245552-65245574 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908657951 1:66407538-66407560 CTGGGGGATCTCTGGGTTGAAGG - Intergenic
908740239 1:67319900-67319922 CTGCGACCTCACATGGTGGAAGG - Intronic
908905684 1:69006194-69006216 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908905853 1:69007932-69007954 CTGTGTCCTCACATGGTGGAAGG + Intergenic
909271559 1:73628913-73628935 CTGGGGCACTACCTAGTGGAGGG - Intergenic
909412197 1:75367636-75367658 CTCGTGCGTCCCTTGGTGGATGG + Intronic
911043761 1:93612085-93612107 CTGGGGCACCACTGGCAGGATGG + Intronic
912269708 1:108196721-108196743 CTGTGTCCTCACATGGTGGAAGG + Intronic
912720889 1:112019014-112019036 CTGTGTCCTCACATGGTGGAAGG - Intergenic
912908726 1:113734833-113734855 CTGTGTCCTCACATGGTGGAAGG - Intronic
913162921 1:116161668-116161690 CTGTGTCCTCACATGGTGGAAGG - Intergenic
913542289 1:119833121-119833143 CCTGGGCATCACTTGTTGAAAGG - Intergenic
913649206 1:120894441-120894463 CTGTGCCCTCACATGGTGGAAGG - Intergenic
914172399 1:145237606-145237628 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914297277 1:146340072-146340094 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914527044 1:148478609-148478631 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914639354 1:149588526-149588548 CTGTGTCCTCACATGGTGGAAGG - Intergenic
915083894 1:153371326-153371348 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915647504 1:157284238-157284260 CTGCGTCCTCACATGGTGGAAGG + Intergenic
915647524 1:157284360-157284382 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915647530 1:157284390-157284412 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915663137 1:157420189-157420211 CTGTGTCCTCACATGGTGGAAGG - Intergenic
917685953 1:177416268-177416290 CTGTGTCCTCACATGGTGGAAGG - Intergenic
917986778 1:180327560-180327582 CTGGGGCGACAATTGGTGGAGGG + Intronic
919019719 1:192088511-192088533 CTGGGTCCTCACGTGGTAGAAGG - Intergenic
919434386 1:197538920-197538942 CTGTGTCATCCCATGGTGGAAGG - Intronic
921128189 1:212196475-212196497 CAGGGGAATCACATGGTGAAAGG - Intergenic
921211093 1:212898946-212898968 CTGTGGCATCACTAGGTGATAGG + Exonic
921887093 1:220317982-220318004 CTGTGTCCTCACATGGTGGAAGG + Intergenic
922175527 1:223194224-223194246 CTGCAGCATCTCGTGGTGGAAGG + Intergenic
922222343 1:223618331-223618353 CTGGGTCCTCACCTGGTGCAAGG - Intronic
922824636 1:228509128-228509150 CTGTGTCCTCACATGGTGGAAGG - Intergenic
922885711 1:229019007-229019029 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923091650 1:230745589-230745611 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923394972 1:233552790-233552812 CTGTGTCCTCACATGGTGGAAGG - Intergenic
923411436 1:233713779-233713801 CTGTGTCATCACATGGTGGAAGG - Intergenic
923536311 1:234854767-234854789 CTGGGGCAAGACTTGATGGTTGG + Intergenic
923899717 1:238312394-238312416 CTGTGTCCTCACATGGTGGAAGG + Intergenic
924047537 1:240047274-240047296 CTGTGTCTTCACATGGTGGAAGG - Intronic
924136356 1:240971169-240971191 CTGTGGCCTCACATGGTAGAAGG - Intronic
924330461 1:242935971-242935993 CTGTGTCCTCACATGGTGGAAGG - Intergenic
924572999 1:245255146-245255168 CTGGGTCATAACATGGTGGAGGG - Intronic
924690749 1:246347707-246347729 CTGTGACATCACATGGTGGAAGG - Intronic
1062955634 10:1538610-1538632 GATGGGCATCACGTGGTGGACGG + Intronic
1063021471 10:2133226-2133248 CTGCCTCATCACATGGTGGAGGG - Intergenic
1063023557 10:2155023-2155045 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1063168786 10:3487269-3487291 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1064286506 10:13996101-13996123 CTGTGTCCTCACATGGTGGAAGG + Intronic
1064319895 10:14295243-14295265 CTAGGGCATCACATGGAGGCAGG - Intronic
1064457394 10:15500527-15500549 CAGGCGCATCACATGGTGAAAGG - Intergenic
1064548019 10:16470311-16470333 CTGTGGCCTCACTTGGAGGCTGG - Intronic
1064581643 10:16798760-16798782 CTGGAGTATGACTTGGTGTAGGG - Intronic
1064594061 10:16925579-16925601 CAGGGGGATTACTTGGTGGTAGG - Exonic
1065361033 10:24889178-24889200 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1065881886 10:30044091-30044113 CTGTGTCATCTCATGGTGGAAGG - Intronic
1066184727 10:32998156-32998178 CTGTGTCCTCACATGGTGGAAGG + Intronic
1066298526 10:34076646-34076668 CTGTGTCCTCACTTGGTGTAAGG - Intergenic
1066583288 10:36903921-36903943 ATGGGGGATAACTTGGGGGAAGG - Intergenic
1067010727 10:42711130-42711152 CAGGGGGATTACTTGGTGGTAGG - Intergenic
1067143982 10:43680209-43680231 CTGAGTCATCCCATGGTGGAAGG - Intergenic
1067312783 10:45130070-45130092 CAGGGGGATTACTTGGTGGTAGG + Intergenic
1067319911 10:45208185-45208207 CTGGAGTATGACTTGGTGTAGGG - Intergenic
1068437754 10:57014636-57014658 CTGTGACCTGACTTGGTGGAAGG - Intergenic
1068848533 10:61708578-61708600 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1069036992 10:63656032-63656054 CTGAGTCCTCACATGGTGGAAGG - Intergenic
1069376176 10:67795210-67795232 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1069527080 10:69181659-69181681 CTGCATCATCACATGGTGGAAGG + Intronic
1069598580 10:69688495-69688517 CTGTGTCATGACATGGTGGAAGG - Intronic
1069628870 10:69885472-69885494 CTGGGACACCACTTTCTGGAGGG - Intronic
1069661247 10:70125058-70125080 CTGAGTCATCCCATGGTGGAAGG - Intronic
1069911259 10:71761240-71761262 CTGGGGCATGACTCAGTGGATGG - Intronic
1070532476 10:77349250-77349272 CTGTGTCCTCACATGGTGGAAGG - Intronic
1071200577 10:83217631-83217653 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1071371747 10:84958258-84958280 CTGGAGTATCACTTGGTGTTTGG + Intergenic
1071549150 10:86552861-86552883 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1071822702 10:89294411-89294433 CTGGGTCATCCCATGATGGAAGG + Intronic
1071860234 10:89664834-89664856 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1071884130 10:89931007-89931029 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1071899150 10:90100383-90100405 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1072045834 10:91653998-91654020 CTGTGGCCTCACATGATGGAAGG + Intergenic
1072598655 10:96901499-96901521 CTGGGGCAGCACTAGGGGGTTGG - Intronic
1072818294 10:98531094-98531116 CTGGGGCATAAAATGTTGGAGGG - Intronic
1074427722 10:113367073-113367095 CTGTGACTTCACGTGGTGGAAGG + Intergenic
1074586082 10:114768527-114768549 CAAGGGCATCACTTAGGGGAAGG - Intergenic
1074625433 10:115178720-115178742 CTGTGTCCTCACATGGTGGAAGG - Intronic
1075161832 10:120031121-120031143 CTGGGTCCTCACAGGGTGGAAGG - Intergenic
1075217742 10:120553394-120553416 CTGTGTCATCACATGGTGGAAGG - Intronic
1076542962 10:131225753-131225775 CTGGGGCATCGCTGTGTGCAGGG - Intronic
1076649712 10:131979501-131979523 CGGGGGCATCACTTCCTTGAAGG - Intronic
1076779639 10:132717145-132717167 CTGCGTCCTCACGTGGTGGAGGG + Intronic
1076919696 10:133445244-133445266 CTGGGGGATCAGGTGTTGGAGGG + Intergenic
1077365109 11:2158445-2158467 CTGTGACATCTCTGGGTGGAGGG + Intronic
1077977506 11:7263310-7263332 CTGTGTCCTCACATGGTGGAAGG + Intronic
1078056659 11:8014795-8014817 CTGTATCCTCACTTGGTGGAAGG + Intergenic
1078414264 11:11152442-11152464 CTGTGTCATCACATGGTGGAAGG + Intergenic
1078499017 11:11850884-11850906 CTGTGTCCTCACATGGTGGAAGG + Intronic
1079519119 11:21303914-21303936 CTGCGTCCTCACATGGTGGAAGG + Intronic
1079551271 11:21701459-21701481 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1079592834 11:22201662-22201684 CTGTGTCATAACATGGTGGAAGG + Intronic
1080195487 11:29603631-29603653 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1080294090 11:30705274-30705296 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1080492698 11:32783579-32783601 CTGTGTCCTCACATGGTGGAAGG + Intronic
1080792215 11:35531612-35531634 CTGAGTCCTCACATGGTGGAAGG + Intergenic
1081163517 11:39781871-39781893 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1082095538 11:48126578-48126600 CTGGGTCTTCACGTGGTTGAAGG + Intronic
1082867622 11:57914141-57914163 CTGAGTCATCCCTTGGTGGAAGG + Intergenic
1082874778 11:57977325-57977347 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1084020081 11:66412079-66412101 CTGAGGTATCTGTTGGTGGAAGG + Intergenic
1085250242 11:75138681-75138703 CTGTGTCCTCACATGGTGGAAGG + Intronic
1085871825 11:80359116-80359138 CTGGGTCCTCACATGGTGGAAGG + Intergenic
1086790429 11:91030733-91030755 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1087087009 11:94230071-94230093 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1087917539 11:103828649-103828671 CTGTGTCATCACATGGTGAAAGG - Intergenic
1088489973 11:110377592-110377614 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1088840672 11:113624999-113625021 CTATGCCCTCACTTGGTGGAAGG + Intergenic
1089188111 11:116634828-116634850 CTGTGACTTCACATGGTGGAAGG + Intergenic
1089637072 11:119821735-119821757 CTGGGGCATCCCGCGGTGGATGG + Intergenic
1090550498 11:127814657-127814679 ATCGGGCATCACATGGTGGCTGG - Intergenic
1090621299 11:128563301-128563323 CTGAGTCAACACTGGGTGGATGG + Intronic
1091022087 11:132109362-132109384 CTGTGTCCTCACATGGTGGAAGG - Intronic
1091294304 11:134462083-134462105 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1091369470 11:135046602-135046624 CTGGGGAAGCACTTGTGGGATGG - Intergenic
1092123364 12:6059595-6059617 CTGTGTCCTCACATGGTGGAAGG + Intronic
1092350707 12:7753512-7753534 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1092769202 12:11881549-11881571 CTGTGTCTTCACTTGGTGGAAGG + Intronic
1092908302 12:13122512-13122534 CTGTGTCACCACATGGTGGAAGG + Intronic
1093105580 12:15082249-15082271 CTGTGGCATAACAAGGTGGAAGG + Intergenic
1093135477 12:15444697-15444719 CTGTGTCATCACATGGTGGGAGG - Intronic
1093195180 12:16122141-16122163 CTGCGCCCTCACATGGTGGAAGG + Intergenic
1093562914 12:20563741-20563763 CTAGGGCCTCACTTAGTGTAGGG + Intronic
1093909291 12:24727297-24727319 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1094442872 12:30498659-30498681 CTGTGACCTCACATGGTGGAAGG - Intergenic
1095373489 12:41498464-41498486 CTGTGTCATAACATGGTGGAAGG + Intronic
1096623668 12:52879890-52879912 CTAGGGCATGACTTGGTGAGCGG - Intergenic
1096803659 12:54127474-54127496 CTGGGGCATCTCTTGGGTGGGGG - Intergenic
1096943225 12:55372887-55372909 CAGGGGAATCACTTGCTGGGAGG - Intergenic
1098235524 12:68414547-68414569 CTGTGGTCTCACATGGTGGAAGG - Intergenic
1098492264 12:71095344-71095366 CTGTGTCCTCACATGGTGGAAGG + Intronic
1099360818 12:81698398-81698420 CTGTGTCATCTCATGGTGGAAGG - Intronic
1100027704 12:90150199-90150221 CTGGAACCTCACATGGTGGAAGG - Intergenic
1100593684 12:96053406-96053428 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1100677354 12:96881879-96881901 CAGTGTCCTCACTTGGTGGAAGG + Intergenic
1100841166 12:98612851-98612873 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1100901931 12:99251019-99251041 CTGGGTCCTCACATGGTGGAGGG + Intronic
1101314681 12:103618293-103618315 CTGTATCTTCACTTGGTGGAAGG - Intronic
1101385017 12:104249217-104249239 CTGTGTCCTCACATGGTGGAAGG + Intronic
1101400714 12:104384333-104384355 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1101451698 12:104785695-104785717 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1101510125 12:105385404-105385426 CTGTGTCCTCACTTGGTAGAAGG - Intronic
1101780383 12:107829605-107829627 CTGGGGCTTAACTTCCTGGAGGG + Intergenic
1101833135 12:108274828-108274850 ATGGGCCATCCCATGGTGGAAGG - Intergenic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102057276 12:109906120-109906142 CTGGTGCATCACTTGATACAGGG + Intronic
1102414325 12:112747311-112747333 CTGTGTCCTCACATGGTGGAAGG - Intronic
1102487876 12:113270418-113270440 CTGTGTCCTCACGTGGTGGAAGG + Intronic
1102537018 12:113589228-113589250 CTGGGAGATCTCTTGGAGGATGG + Intergenic
1102812907 12:115839789-115839811 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1103234176 12:119358392-119358414 CTGTGTCATCCCATGGTGGAAGG - Intronic
1103607321 12:122096938-122096960 CTGGGGAATGACTTGGTACATGG + Intronic
1103750093 12:123152127-123152149 CTAGGGCACCTCTTGGTGGAGGG - Intergenic
1103786298 12:123435898-123435920 CTGGGGGATCACTTGGAGCCAGG + Intronic
1103966451 12:124642964-124642986 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1104128778 12:125872799-125872821 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1104236363 12:126941752-126941774 CTGTGTCCTCACATGGTGGAGGG + Intergenic
1104414714 12:128588722-128588744 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1104521354 12:129478359-129478381 CTAGGGCATCACTGGGTGATAGG + Intronic
1104544732 12:129700454-129700476 CTGGGGCACCACTTGCTCGATGG + Exonic
1104547728 12:129727298-129727320 CTGTGTCATAACATGGTGGAAGG + Intronic
1104979233 12:132566202-132566224 CTGCGTCCTCACATGGTGGAAGG + Intronic
1105046198 12:133005761-133005783 CTATGTCATAACTTGGTGGAAGG - Intronic
1105658805 13:22470561-22470583 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1105737337 13:23285216-23285238 CTGGGACAGCACCTGGGGGAAGG - Intronic
1105934143 13:25083172-25083194 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1106223504 13:27767455-27767477 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1106281582 13:28278188-28278210 CTGGGGTATGAATTGGGGGATGG + Intronic
1106797877 13:33226045-33226067 CTGTGCCCTCACATGGTGGAGGG - Intronic
1106920015 13:34553236-34553258 ATGGGGAATCACTTCATGGATGG + Intergenic
1106999352 13:35525834-35525856 CTGTGTCTTCACATGGTGGAAGG + Intronic
1107277008 13:38688938-38688960 CTGGTGCTTCGCATGGTGGATGG + Exonic
1107300799 13:38963881-38963903 CTGTGTCCTCAGTTGGTGGAAGG - Intergenic
1107400823 13:40067311-40067333 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1107600127 13:42004617-42004639 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1107911987 13:45114145-45114167 CTGAGTTATCACTTGGTAGATGG + Intergenic
1108161466 13:47644724-47644746 CTGGGTCCTCATATGGTGGAAGG - Intergenic
1108606073 13:52039997-52040019 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1109281121 13:60356811-60356833 CTGTGTCCTCACTTGGTAGAAGG + Intergenic
1109478094 13:62911506-62911528 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1109702186 13:66040688-66040710 CTGTGGCTTCACATAGTGGAAGG + Intergenic
1109752886 13:66719451-66719473 CTGAGTCCTCACATGGTGGAGGG - Intronic
1110487300 13:76061551-76061573 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1111260563 13:85734377-85734399 CTGTGTCCTCACATGGTGGAGGG - Intergenic
1111608994 13:90578985-90579007 CTGTGTCCTCACATGGTGGAGGG + Intergenic
1111720301 13:91935423-91935445 CTGTGTCCTCACATGGTGGAAGG - Intronic
1112523745 13:100122874-100122896 CTGTGTCCTCACATGGTGGAAGG + Intronic
1112998608 13:105604596-105604618 CTGGGCCTTCACATGGTGGAAGG + Intergenic
1113813344 13:113155034-113155056 CTGCGTCATCCCATGGTGGAAGG - Intergenic
1113834483 13:113319663-113319685 CTGGGGCCTCACCTGGGAGAGGG + Intronic
1114569253 14:23654441-23654463 CTGAGACAGCACTAGGTGGATGG - Intergenic
1115736698 14:36339316-36339338 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1115863649 14:37717972-37717994 CTGTGTCCTCACATGGTGGAAGG - Intronic
1116452725 14:45083352-45083374 ATGAGGCATCACCTGGGGGATGG - Intergenic
1116571716 14:46525603-46525625 GTGGGGCATCAGTTGGAGGGGGG + Intergenic
1116948516 14:50857801-50857823 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1117157701 14:52957184-52957206 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1117316623 14:54577197-54577219 CTGGGGCAACACTTGGCCAAGGG - Intronic
1117514356 14:56485682-56485704 CTGAGTCCTCACATGGTGGAAGG - Intergenic
1118068285 14:62216422-62216444 CTGCGTCTTCACATGGTGGAAGG - Intergenic
1118072529 14:62261427-62261449 CTGGGTCCTCACGTGGTGGAAGG - Intergenic
1119508687 14:75194359-75194381 CTGCGTCATCTCATGGTGGAAGG - Intergenic
1119547653 14:75484122-75484144 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1119876163 14:78061130-78061152 CTGTGTCTTCTCTTGGTGGAAGG - Intergenic
1119911468 14:78353432-78353454 CTGTGTCCTCACATGGTGGAAGG + Intronic
1120498908 14:85269687-85269709 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1120760008 14:88276284-88276306 CTGTGTCCTCACTCGGTGGAAGG - Intronic
1120916463 14:89714951-89714973 CTGTGGCCTCATGTGGTGGAGGG + Intergenic
1121069919 14:91009279-91009301 CTGTGTCCTCACATGGTGGAAGG - Intronic
1121853171 14:97242374-97242396 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1122350348 14:101085974-101085996 CTGGGCCATCCTATGGTGGAAGG - Intergenic
1122495843 14:102154365-102154387 CTGTGTCCTCACATGGTGGAGGG + Intronic
1122833499 14:104417747-104417769 CTGTGTCCTCACTTGGTGGAAGG - Intergenic
1123122329 14:105922518-105922540 CTGTGTCATCACATGGCGGAAGG - Intronic
1123632077 15:22268458-22268480 CTGGGACATCCCATGGTGGAAGG - Intergenic
1124096006 15:26649339-26649361 CTGGGTCATCACATGGTGGAGGG - Intronic
1124395954 15:29301833-29301855 CTGTGTCCTCACATGGTGGAAGG - Intronic
1124412240 15:29446091-29446113 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1125217249 15:37289553-37289575 CTGTGTCTTCACCTGGTGGAAGG + Intergenic
1125370042 15:38965596-38965618 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1125788188 15:42341332-42341354 CTGTGAGATCACTTGGGGGAAGG + Intronic
1126243997 15:46481955-46481977 CTGTATCATCACATGGTGGAAGG - Intergenic
1126358742 15:47823591-47823613 CTGAGACCTCACATGGTGGAAGG - Intergenic
1127093824 15:55493109-55493131 CTGTGTCCTCACATGGTGGAAGG - Intronic
1127783777 15:62338679-62338701 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1128203562 15:65830652-65830674 CTGGGGCCTCACTTGGTTCGTGG - Intronic
1128405470 15:67333051-67333073 CTGTGTCCTCACATGGTGGAGGG + Intronic
1128507687 15:68287772-68287794 CTGTGTCCTCACATGGTGGAAGG + Intronic
1128901603 15:71427770-71427792 CTGGGGAATGACTTAATGGAGGG - Intronic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1129580471 15:76803667-76803689 CTGTGTCTTCACATGGTGGAGGG + Intronic
1130050113 15:80477343-80477365 CTGTGTCCTCACATGGTGGAAGG + Intronic
1130052182 15:80493081-80493103 CTGTGTCATCCCATGGTGGAAGG + Intronic
1130555486 15:84919566-84919588 CTGTGTCATAACATGGTGGAAGG + Intronic
1130600983 15:85273036-85273058 ATGGGGCAACACTTTGTGAATGG + Intergenic
1131960393 15:97784471-97784493 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1132195582 15:99912371-99912393 CTGGGGCATGAATTAGTTGAGGG + Intergenic
1133256460 16:4519536-4519558 CTGTGTCATCCCATGGTGGAAGG - Intronic
1134055884 16:11169643-11169665 CTGTCTCATCACTTGGGGGATGG - Intronic
1134156135 16:11844719-11844741 CTGGGGAATCTCTGGGTGGAAGG + Intronic
1135097637 16:19577788-19577810 CTGTGTTTTCACTTGGTGGAAGG - Intronic
1135129770 16:19843735-19843757 CTGGGTCATCACATGGGAGAGGG + Intronic
1136058536 16:27708773-27708795 CTGGGGCAACTCGTGGTGGGTGG + Exonic
1137386745 16:48049069-48049091 CTGTGTCCTCACTTGGCGGAAGG - Intergenic
1137479846 16:48843140-48843162 CTGTGGCAAAACTTGGTGGCTGG - Intergenic
1137595156 16:49718732-49718754 CTGCGTCCTCACATGGTGGAAGG + Intronic
1138215770 16:55204010-55204032 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1138346241 16:56322053-56322075 CTGCGTCCTCACGTGGTGGAAGG + Intronic
1138422369 16:56907676-56907698 CTGTGTCCTCACTTGGCGGAGGG + Intronic
1138693212 16:58788174-58788196 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1138730001 16:59184098-59184120 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1139314526 16:66056928-66056950 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140554656 16:75907997-75908019 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1140694027 16:77514076-77514098 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1140886563 16:79249463-79249485 CTCTGGCCTCACATGGTGGAAGG - Intergenic
1141151081 16:81565155-81565177 CTGGGGCATCCCTTGGCCGAAGG - Intronic
1141429657 16:83965135-83965157 CTGGGGCATAACTTTGTGTCCGG + Exonic
1141702379 16:85648443-85648465 CTGGGGCCTCACTTGGAGCAGGG + Intronic
1141777467 16:86133914-86133936 CTGTGCCATCACTTGGTGGAAGG - Intergenic
1141970918 16:87481929-87481951 CTAGGACATCCCATGGTGGAAGG + Intronic
1143137703 17:4720934-4720956 CTGTGGCATAGCTTGGTGGTGGG - Exonic
1143316893 17:6039719-6039741 CTGTGCCCTCACATGGTGGAAGG + Intronic
1144147932 17:12416182-12416204 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1144702697 17:17349292-17349314 CTGGGGGCTGACTTGGTGCAGGG + Intergenic
1145103105 17:20093254-20093276 CAGTGCCCTCACTTGGTGGAAGG + Intronic
1145743604 17:27296193-27296215 GTGGGGGAACACTTAGTGGATGG - Intronic
1145837525 17:27965856-27965878 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1146303104 17:31706634-31706656 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1146530249 17:33602449-33602471 CTGTGTCATAACATGGTGGAAGG - Intronic
1146625535 17:34432272-34432294 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1147421416 17:40323820-40323842 CTGAGGCAGGACTTGGTGGGGGG + Intronic
1148054586 17:44786629-44786651 CTGGGCCACCACTGGGTGCAGGG + Intergenic
1148412271 17:47477859-47477881 CTGTGTCATCAGTGGGTGGAAGG + Intergenic
1149917975 17:60629363-60629385 CTGAGCCATCACTTGGGAGATGG + Intronic
1151475629 17:74343001-74343023 CTGGGGCAGAACAAGGTGGAGGG - Intronic
1151512881 17:74572200-74572222 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1152091240 17:78249073-78249095 CTGGGGAAGCCCTCGGTGGACGG - Intergenic
1152126217 17:78448803-78448825 CTGTGTCATCCCATGGTGGAAGG - Intronic
1152372194 17:79895891-79895913 CTGAGTCCTCACTTGGTGGAAGG - Intergenic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152477051 17:80525403-80525425 CTGTGTCCTCACGTGGTGGAGGG - Intergenic
1152546459 17:81002543-81002565 CTGCGTCATCACATGGTGGAAGG + Intronic
1153100914 18:1468599-1468621 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1153426387 18:4969435-4969457 CTGTGACCTCACATGGTGGAAGG - Intergenic
1153668987 18:7392387-7392409 CTGTGTCTTCACGTGGTGGAAGG - Intergenic
1153764811 18:8365388-8365410 CTGTGGCCTCACTTAGTGGATGG - Intronic
1154393824 18:13968960-13968982 CTGTGGCATCACATGGTGGAAGG + Intergenic
1155233422 18:23796007-23796029 CTGGGTCCTCACATGGTAGAGGG - Intronic
1155254745 18:23985013-23985035 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1155769661 18:29680920-29680942 CTGGGTCCTCACATGGTAGAAGG + Intergenic
1156241339 18:35257493-35257515 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1157430096 18:47617515-47617537 CTGTGTCATCTCATGGTGGAAGG - Intergenic
1158390649 18:57042246-57042268 CTGTGGCCTCACATGGTGGAAGG + Intergenic
1158620400 18:59027858-59027880 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1159270379 18:66141563-66141585 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1159829395 18:73255871-73255893 CTGCGTCATCCCATGGTGGAAGG + Exonic
1160185406 18:76672786-76672808 CTGCGTCAGCACATGGTGGAAGG - Intergenic
1160609907 18:80076884-80076906 CTGTGTCCTCACGTGGTGGAAGG + Intronic
1160687879 19:445326-445348 CTGTGTCCTCACGTGGTGGAGGG - Intronic
1161081982 19:2315848-2315870 CTGGAGCGGCACCTGGTGGAAGG + Intronic
1162384351 19:10352541-10352563 CTGGGGCATACCTAGGGGGAGGG + Exonic
1162502940 19:11064860-11064882 CTGAGACATCAGTTGGTGGTTGG + Intronic
1163256758 19:16160699-16160721 CTGGGGCAACCCCAGGTGGAGGG + Intergenic
1163364734 19:16869614-16869636 CTGGTGCAGCAGCTGGTGGATGG - Exonic
1164707337 19:30329823-30329845 CTGGGTCTACACTTGGTGGGGGG + Intronic
1167735075 19:51289408-51289430 CTGTGTCCCCACTTGGTGGAAGG + Intergenic
924988875 2:294425-294447 CTGAGTCCTCACGTGGTGGAGGG + Intergenic
925303156 2:2831123-2831145 CTGGGTCATCCCATGGTGGAAGG - Intergenic
925483364 2:4301416-4301438 CTGTGTCCTCACATGGTGGAAGG - Intergenic
925712279 2:6752999-6753021 CTGTGTCTTCACGTGGTGGAAGG - Intergenic
926364928 2:12124283-12124305 CTGGGGCAACACTTGGTCAGAGG - Intergenic
926452892 2:13027307-13027329 CTGTGTCCTCACATGGTGGAAGG + Intergenic
927072569 2:19546024-19546046 CTGTGTCATAACATGGTGGAGGG - Intergenic
927173115 2:20387015-20387037 CTGCAGCATCATGTGGTGGAAGG - Intergenic
927311310 2:21634825-21634847 CTGTGTCCTCACATGGTGGAAGG - Intergenic
927434945 2:23058755-23058777 CTGGGGCATGTCTGGGTGGCGGG - Intergenic
927592467 2:24368114-24368136 CTGTGTCTTCACTTGGTGGAAGG - Intergenic
927976525 2:27342794-27342816 GTGGGGCATAGCTTGGTGGAGGG - Intronic
928257163 2:29732740-29732762 CTGTGTCCTCACATGGTGGAAGG - Intronic
928306227 2:30172374-30172396 CAGTGGCATCACTTGGGGAAGGG + Intergenic
928694017 2:33830421-33830443 CTGTGTCCTCACATGGTGGAAGG - Intergenic
929228114 2:39531623-39531645 CTGTGTCCTCACATGGTGGAAGG + Intergenic
929263582 2:39893946-39893968 CTGGAGCATCACTCTGGGGAGGG - Intergenic
930107175 2:47649474-47649496 CTGTGTCCTCACATGGTGGAGGG - Intergenic
930253667 2:49064466-49064488 CTGAGTCCTCACATGGTGGAAGG - Intronic
930851748 2:55968477-55968499 CTGTGTCCTCACATGGTGGAGGG - Intergenic
932326890 2:70869156-70869178 CTGAGTCATCACATGGTGGAGGG - Intergenic
933133887 2:78707359-78707381 CTGTGTCCTCACATGGTGGAGGG + Intergenic
933238364 2:79890885-79890907 CTGTGTCATCACATGGTGGAAGG + Intronic
933240296 2:79913428-79913450 CTGAGGCATCAGTCGGTGCAGGG + Intronic
933982398 2:87562410-87562432 CTGTGTCCTCACATGGTGGAGGG + Intergenic
934694303 2:96387940-96387962 CTGCGACCTCACATGGTGGAAGG - Intergenic
935679681 2:105625099-105625121 CTGGTTCCTCACTAGGTGGATGG + Intergenic
936619457 2:114080414-114080436 CTGTGTCATCACATGGTGGAAGG + Intergenic
936946338 2:117934333-117934355 CTGGGGTATGAGTAGGTGGAGGG - Intronic
937088620 2:119189621-119189643 CTGTGTCCTCACATGGTGGAGGG - Intergenic
938556852 2:132432270-132432292 CTGTGTCCTCACATGGTGGAAGG + Intronic
939727775 2:145744751-145744773 GTGGTACATCACTTGCTGGATGG - Intergenic
940363706 2:152822412-152822434 CTGCGTCCTCACATGGTGGAAGG + Intergenic
941709439 2:168696681-168696703 CTGTGTCCTCACATGGTGGAAGG + Intronic
942638038 2:178029937-178029959 CTGTGGCATAACATGGTGGAAGG - Intronic
942999493 2:182307426-182307448 CTGCATCATCACATGGTGGAAGG - Intronic
943195627 2:184744485-184744507 CTGTGTCCTCACATGGTGGAAGG - Intronic
943204804 2:184880758-184880780 CTGTGTCATCCCATGGTGGAAGG + Intronic
943306827 2:186273261-186273283 CTGTGTCATCACATAGTGGAGGG - Intergenic
944167085 2:196734514-196734536 CTGTGTCCTCACATGGTGGAAGG - Intronic
944636478 2:201680392-201680414 CTGGGTCCTCCCATGGTGGAAGG + Intronic
946113258 2:217438504-217438526 CTGTGTCCTCACATGGTGGAAGG - Intronic
946331533 2:219012018-219012040 CTGTGTCCTCACATGGTGGAGGG - Intronic
946972348 2:225108558-225108580 CTGTGTCCTCACATGGTGGAAGG + Intergenic
947361791 2:229352854-229352876 CTGTGTCCTCACATGGTGGAAGG - Intergenic
947803107 2:232944287-232944309 ATGTGGCGTCACTGGGTGGAAGG - Intronic
947814594 2:233027881-233027903 CTGTGTCCTCACATGGTGGAGGG + Intergenic
948364669 2:237446950-237446972 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
948512470 2:238477948-238477970 CTGTGTCCTCACATGGTGGAAGG - Intergenic
948522903 2:238552243-238552265 CTGTGTCCTCACATGGTGGAAGG - Intergenic
948578976 2:238971378-238971400 CTGGTGCAGCACTTGGTGTATGG + Intergenic
948582950 2:239000326-239000348 CTGTGCCCTCACATGGTGGAAGG + Intergenic
948661855 2:239512176-239512198 CTGCGGCCCCACGTGGTGGAAGG - Intergenic
948744398 2:240076091-240076113 CAAGAGCATCACCTGGTGGATGG - Intergenic
1169124726 20:3119259-3119281 CTGAGGCCTCACTTGCTGGTTGG - Intronic
1169286930 20:4316824-4316846 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1169356691 20:4912815-4912837 CCGGGGCAGCACTTGTGGGAGGG + Intronic
1169594574 20:7183280-7183302 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1169752341 20:9007118-9007140 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1169944645 20:10975625-10975647 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1170509772 20:17064748-17064770 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1170547912 20:17450709-17450731 CTGGGTCTTCCCATGGTGGAAGG + Intronic
1170638617 20:18131754-18131776 ATGAGGCAGCACTTGGAGGATGG - Intergenic
1170796934 20:19556045-19556067 CTGTGTCCTCACATGGTGGAAGG + Intronic
1171431748 20:25087246-25087268 CTGCCACATCACATGGTGGAAGG - Intergenic
1171726253 20:28623884-28623906 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1171778403 20:29393473-29393495 CTGGGGACTCACTCGGTGAATGG - Intergenic
1171790447 20:29518379-29518401 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1171857265 20:30358456-30358478 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1172660290 20:36563414-36563436 CTGCCTCATCACATGGTGGAAGG + Intergenic
1172822372 20:37748745-37748767 CTGCGTCCTCACATGGTGGAAGG + Intronic
1173291510 20:41719072-41719094 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1173339329 20:42139554-42139576 CTGGGGTATTTCATGGTGGAGGG + Intronic
1173433005 20:43008286-43008308 CTGGAGCTTCACATGGTGGAAGG - Intronic
1173435818 20:43031355-43031377 CTGTGTCTTCACTTGGTGGAAGG - Intronic
1173574586 20:44103943-44103965 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1174681452 20:52412666-52412688 CTGTGTCATAACATGGTGGAGGG - Intergenic
1175552380 20:59825946-59825968 CTGTGTCCTCACATGGTGGAGGG - Intronic
1175630971 20:60536140-60536162 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1175680985 20:60988715-60988737 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1175996555 20:62814606-62814628 CTGGGGCACCCCTGGGTGGGAGG + Intergenic
1176378281 21:6097889-6097911 CTGCGGCATCCCAAGGTGGAAGG + Intergenic
1178097013 21:29226793-29226815 CTGTGTCCTCACATGGTGGAAGG + Intronic
1178458293 21:32776586-32776608 CTGAGTCCTCACATGGTGGAAGG + Intergenic
1178608844 21:34062651-34062673 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1178817483 21:35944993-35945015 TTGTGTCCTCACTTGGTGGAAGG - Intronic
1179258444 21:39737841-39737863 CTGCCGCATCCCTTGGAGGAAGG - Intergenic
1179745191 21:43440358-43440380 CTGCGGCATCCCAAGGTGGAAGG - Intergenic
1179842715 21:44087618-44087640 CTGGGCCATCACCTGCTGTAAGG + Intronic
1180318953 22:11303461-11303483 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1180336263 22:11579113-11579135 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1181960681 22:26619681-26619703 CTGGGCCAAGACTTGGTGGGTGG + Intergenic
1182831693 22:33309505-33309527 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1182931144 22:34175482-34175504 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1183036291 22:35143269-35143291 CTGAGTCACCACTTGGAGGAGGG + Intergenic
1183048508 22:35241418-35241440 CTGGGCCAGAACTTGGGGGAGGG - Intergenic
1184115818 22:42421578-42421600 CTGGCCCATGACTTGGTGGTGGG - Intronic
1184776571 22:46626425-46626447 CGGGGGCCTCGCTTGGTGGGAGG + Intronic
1184816003 22:46870719-46870741 CTGTGTCATCACATGGTCGAAGG + Intronic
1185005075 22:48271056-48271078 CTGTGTCCTCACATGGTGGAAGG + Intergenic
949372717 3:3352957-3352979 CTGTGTCCTCACATGGTGGAAGG - Intergenic
949527004 3:4914979-4915001 CTGTGTTGTCACTTGGTGGAAGG + Intergenic
949893334 3:8749483-8749505 CTGGGGCATCTCTGGCTGGTGGG + Intronic
949931533 3:9082388-9082410 CTGTGTCTTCACATGGTGGAAGG - Intronic
949957077 3:9277967-9277989 CTGTGTCCTCACATGGTGGAAGG - Intronic
950896633 3:16457950-16457972 CTGTGTCCTCACATGGTGGAAGG - Intronic
952434323 3:33257114-33257136 CTGTGTCCTCACATGGTGGAAGG - Intergenic
952509820 3:34041834-34041856 CTGTGTCCTCACATGGTGGAAGG - Intergenic
953962062 3:47273897-47273919 CCGGATCATCTCTTGGTGGAGGG - Intronic
954406001 3:50345411-50345433 CTGGGGCCTGACTCGGGGGAGGG - Intronic
955165126 3:56503475-56503497 CTGTGTCTTCACATGGTGGAAGG + Intergenic
955360004 3:58265769-58265791 CTGTGTCATCCCGTGGTGGAAGG + Intronic
955515649 3:59724026-59724048 CTGTGTCCTCACATGGTGGAAGG + Intergenic
955525944 3:59819919-59819941 CTGTGTCCTCACATGGTGGAAGG - Intronic
955541440 3:59980692-59980714 CTGTGTCCTCACATGGTGGAAGG - Intronic
955713945 3:61809114-61809136 CTGGGCCTTCACTATGTGGAAGG - Intronic
956041561 3:65150397-65150419 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
957114339 3:76005053-76005075 CTGTGCCATCTCATGGTGGAAGG - Intronic
957791057 3:84941851-84941873 CTGTGTCCTCACATGGTGGAAGG + Intergenic
958411703 3:93825195-93825217 CTGTGTCCTCACATGGTGGAAGG + Intergenic
958836023 3:99146024-99146046 CTGTGTCCTCACATGGTGGAAGG - Intergenic
959141703 3:102493730-102493752 CTGTCTCTTCACTTGGTGGAAGG - Intergenic
959210849 3:103378339-103378361 CTGGGTCCTCACATGGTGTAAGG + Intergenic
959546025 3:107597873-107597895 CTGGGGCATTGCTTGGGGTAGGG - Intronic
959770190 3:110085671-110085693 CTGTGTCCTCACATGGTGGAAGG - Intergenic
959808714 3:110591660-110591682 CTGGTGTATCACATGGTGAAAGG + Intergenic
959877046 3:111395378-111395400 CTGTGTCTTCACATGGTGGAAGG - Intronic
959910599 3:111759311-111759333 CTGTGTCCTCACATGGTGGAAGG + Intronic
960121594 3:113952805-113952827 CTGTGTCCTCACATGGTGGAAGG + Intronic
960360405 3:116704210-116704232 CTGGGTCATCCCATGATGGAAGG + Intronic
960694856 3:120386145-120386167 CTGTGTCTTCGCTTGGTGGAAGG - Intergenic
960859391 3:122136061-122136083 CTGTGTCATCCCATGGTGGAAGG + Intergenic
961074861 3:123973004-123973026 ATGTGTCCTCACTTGGTGGAGGG + Intronic
961251802 3:125513217-125513239 CTGTGTCCTCACATGGTGGAAGG - Intronic
961308817 3:125979477-125979499 ATGTGTCCTCACTTGGTGGAGGG - Intronic
961485316 3:127211825-127211847 CTGAGGCTTCAGTTGGAGGAGGG + Intergenic
961990000 3:131179124-131179146 CTGTGTCCTCACATGGTGGAAGG - Intronic
963059707 3:141215339-141215361 CTGCGTCCTCACATGGTGGAAGG + Intergenic
963071660 3:141309894-141309916 CTGTGTCCTCACATGGTGGAAGG - Intergenic
963262639 3:143208206-143208228 CTGTGTCCTCACATGGTGGAAGG + Intergenic
963390779 3:144661094-144661116 CTGTGTCTTCACATGGTGGAAGG + Intergenic
963462791 3:145638175-145638197 CTGTGTCTTCACATGGTGGAAGG - Intergenic
963989363 3:151635413-151635435 CTGTGTCCTCACATGGTGGAAGG + Intergenic
964102248 3:153001307-153001329 CTGTGTCATCCCATGGTGGAAGG + Intergenic
964534607 3:157705994-157706016 CTGGGGCATCCCTTGGTCAAAGG - Intergenic
964964313 3:162472124-162472146 CTGTGTCATCACATGGTGGAAGG + Intergenic
965443457 3:168745607-168745629 CTGTGTCCTCACATGGTGGAAGG + Intergenic
965759869 3:172064189-172064211 CTGTGTCCTCACATGGTGGAGGG - Intronic
965784223 3:172319214-172319236 TTGGGCCTTCACTAGGTGGATGG + Intronic
965968294 3:174523004-174523026 CTGTGTCCTCACATGGTGGAAGG - Intronic
965988894 3:174791402-174791424 CTGTGTCCTCACGTGGTGGAAGG - Intronic
966003834 3:174983598-174983620 CTGTGTCCTCACATGGTGGAAGG + Intronic
966149455 3:176850659-176850681 CTGGTGCCTCGGTTGGTGGAGGG - Intergenic
966716075 3:183014002-183014024 CTGTGTCATAACATGGTGGAGGG + Intergenic
966716652 3:183019467-183019489 CTGTGTCCTCACGTGGTGGAAGG - Intronic
967327615 3:188257913-188257935 CTGTAGCAGCACTGGGTGGAAGG - Intronic
967877260 3:194275824-194275846 CAGGGGCTTCATGTGGTGGAAGG - Intergenic
969104792 4:4797526-4797548 CTGGGTCATCCCATGGTGGATGG + Intergenic
969230794 4:5828907-5828929 CTGGGGCATCACAAAGAGGAAGG + Intronic
969306336 4:6328145-6328167 CTTGGGCATCACCTGGTGGGGGG - Intronic
969516389 4:7650597-7650619 CTGGGGCATCATTTTATAGATGG + Intronic
970156637 4:13148959-13148981 CTGGCTCATCACTTACTGGATGG - Intergenic
970422934 4:15921862-15921884 GTGGGGACTCTCTTGGTGGATGG - Intergenic
971353885 4:25877050-25877072 CTGTGTCCTCACATGGTGGAAGG - Intronic
971714307 4:30155537-30155559 CTGTGTCCTCACTTGGTAGAAGG + Intergenic
972297133 4:37750634-37750656 CTGTGTCCTCACATGGTGGAAGG - Intergenic
972847704 4:43009650-43009672 CTGTGTCATCACATGGTAGAAGG + Intronic
972990449 4:44817199-44817221 CTGTGTCCTCACATGGTGGAAGG + Intergenic
973140229 4:46757910-46757932 CTGGGGCATCATGTGGTGGAGGG + Intronic
973770934 4:54205813-54205835 CTGCGTCCTCACATGGTGGAAGG + Intronic
974667256 4:64979922-64979944 CTATGGCATCACTAGGTGAAAGG - Intergenic
976118461 4:81754058-81754080 CTATGTCCTCACTTGGTGGAAGG + Intronic
976437341 4:85033285-85033307 CTGTGTCATCACATGGTAGAAGG + Intergenic
976764498 4:88585099-88585121 CTGTGTCCTCACATGGTGGAAGG + Intronic
977263097 4:94822123-94822145 CTGTGTCATCTCATGGTGGAAGG + Intronic
977381357 4:96278367-96278389 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
977653973 4:99500959-99500981 CTGTGCCTTCACATGGTGGAAGG + Intergenic
978171447 4:105675805-105675827 TTGGGCCCTCACATGGTGGAAGG + Intronic
978285025 4:107066883-107066905 CTGTGTCCTCACATGGTGGAAGG - Intronic
978696567 4:111587184-111587206 CTGTGTCCTCACATGGTGGAAGG + Intergenic
979206485 4:118044771-118044793 CTGTGTCATCTCATGGTGGAAGG + Intronic
979665777 4:123309358-123309380 CTGTGTCCTCACATGGTGGAAGG + Intronic
979714600 4:123822581-123822603 CTGTGCCCTCACATGGTGGACGG + Intergenic
979727090 4:123975052-123975074 CTGTGTCCTCACATGGTGGAAGG - Intergenic
979765843 4:124463266-124463288 CTGGGGCTTCACTGGGTGGATGG - Intergenic
980114527 4:128666494-128666516 CTGAGCCATCACATGGTGGAAGG + Intergenic
980508390 4:133754126-133754148 CTGTGGCCTCACATGTTGGAAGG + Intergenic
980727066 4:136776542-136776564 CTGTGTCCTCACATGGTGGAAGG - Intergenic
981686538 4:147460729-147460751 CTGGGTCCTCACATGGCGGAAGG - Intergenic
981890560 4:149731300-149731322 CTGTGTCTTCACATGGTGGAAGG - Intergenic
981917585 4:150051683-150051705 CTGGGTCCTCACATGGTGGAAGG - Intergenic
982115333 4:152094235-152094257 CTGTGTCCTCACATGGTGGACGG - Intergenic
982177292 4:152718166-152718188 CTGCATCCTCACTTGGTGGAAGG + Intronic
982203753 4:152981797-152981819 CTGTGTCCTCACATGGTGGAAGG - Intergenic
982280827 4:153682425-153682447 CTGGTGGATCACTTGGTGCCAGG + Intergenic
982419785 4:155181628-155181650 TTGTGGCTTCACTTGGTGGAAGG - Intergenic
982743202 4:159079337-159079359 CTGTGTCCTCACATGGTGGAAGG - Intergenic
983155472 4:164341631-164341653 CTGTGTCATCATGTGGTGGAAGG + Intronic
983491651 4:168397071-168397093 CTGTGTCCTTACTTGGTGGAAGG - Intronic
984215338 4:176905786-176905808 CTGTGCCCTCACTTGGTGGAAGG - Intergenic
984260288 4:177436603-177436625 CTGTGTCGTCACGTGGTGGAAGG - Intronic
984523752 4:180831649-180831671 CTGAGTCCTCACTTGGTGGAGGG + Intergenic
984684385 4:182649778-182649800 CTGGGGCAGTACTTGGGGGCTGG - Intronic
984753258 4:183299132-183299154 CTGTGTCATCCCATGGTGGAGGG + Intronic
985434274 4:189913817-189913839 CTGTGTCCTCACATGGTGGAAGG - Intergenic
985757401 5:1727114-1727136 CTGGGGCCTCACGTGGCGCAGGG + Intergenic
985773557 5:1827877-1827899 CTGTGTCCTCACTTTGTGGAAGG - Intergenic
985795019 5:1955853-1955875 CTGTGGGGTCATTTGGTGGATGG + Intergenic
985795122 5:1956335-1956357 CTGTGGGGTCATTTGGTGGATGG + Intergenic
986183981 5:5419430-5419452 CTGGGGCATCCTAGGGTGGAAGG - Intergenic
986670664 5:10140166-10140188 CTGTGTCCTCACATGGTGGAAGG - Intergenic
986867092 5:12002344-12002366 CTGTGTCTTCACTTGTTGGAAGG + Intergenic
986867984 5:12012581-12012603 CTGTGCCCTCACATGGTGGAAGG - Intergenic
987225269 5:15833283-15833305 CTGTGTCCTCACATGGTGGAAGG + Intronic
987302026 5:16605779-16605801 CTGTGTCCTCACATGGTGGAAGG + Intronic
987436994 5:17906587-17906609 CTGTGTCTTCACATGGTGGAAGG - Intergenic
988482988 5:31645247-31645269 CTGGGGCATCACTGTGTTAAGGG - Intronic
988580220 5:32462240-32462262 CTGCGCCATCACATGGTGGAAGG - Intergenic
989289408 5:39745937-39745959 CTGTGTCCTCACATGGTGGAAGG + Intergenic
989312745 5:40039448-40039470 CTGCACCATCACATGGTGGAAGG + Intergenic
989554564 5:42778326-42778348 CTGGGTCATCTCTTGGGGGGTGG - Intronic
989980481 5:50637736-50637758 CTGTGTCCTCACATGGTGGAAGG - Intergenic
990700167 5:58466505-58466527 CTGTGGTCTCACATGGTGGAAGG - Intergenic
990845220 5:60130044-60130066 CTGTGTCCTCACATGGTGGAAGG - Intronic
991300086 5:65121539-65121561 CTGGGTCCTCACTTGGCAGAAGG + Intergenic
991403538 5:66278792-66278814 CTGGGTCTTCACCTGGTGGAAGG + Intergenic
991445136 5:66691656-66691678 CTGTGTCTTCACTTGGTGGAAGG + Intronic
991445250 5:66692770-66692792 CTATGTCCTCACTTGGTGGAAGG + Intronic
991558255 5:67920849-67920871 CTGTGTCCTCACATGGTGGAAGG - Intergenic
992388037 5:76304701-76304723 CTGTGTCCTCACATGGTGGAAGG + Intronic
992943481 5:81786401-81786423 CTGTGTCCTCACATGGTGGAAGG + Intergenic
993121400 5:83779190-83779212 CTGCGTCATCCCATGGTGGAAGG + Intergenic
993281706 5:85933455-85933477 CTGTGTCCTCACATGGTGGAAGG - Intergenic
994047713 5:95328358-95328380 CTGTGTCCTCACATGGTGGAAGG - Intergenic
995046331 5:107652974-107652996 CTGGGGCATCAGATGGGTGAGGG - Intronic
996178303 5:120387367-120387389 CTGTGTCCTCACATGGTGGAAGG + Intergenic
996214022 5:120845879-120845901 CTGTGTCCTCACATGGTGGAAGG - Intergenic
996306709 5:122055202-122055224 CTGAGTCCTCACATGGTGGAAGG + Intronic
996331271 5:122331680-122331702 CTGTGTCCTCACATGGTGGAAGG + Intronic
996915031 5:128702225-128702247 CTGTGTCATCACATGGTGGAAGG - Intronic
997345927 5:133192015-133192037 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
997502506 5:134387620-134387642 CTGTGACATCCCATGGTGGAAGG + Intronic
997720461 5:136074534-136074556 CTGTAGCCTCACTTGGTGGAGGG - Intergenic
997855961 5:137373053-137373075 CTGCATCATCACATGGTGGAAGG - Intronic
999300287 5:150486376-150486398 CTGGGGCGCCACTCGGGGGAAGG - Intronic
999726506 5:154442639-154442661 CTGGGGCCTGACTGGATGGAAGG + Intergenic
999734229 5:154500616-154500638 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1000259042 5:159568392-159568414 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1000284534 5:159815719-159815741 CTGTGTCATCACTTGGTGGAAGG - Intergenic
1001191275 5:169634049-169634071 CTGTGCCATCCCGTGGTGGAAGG - Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001446854 5:171792004-171792026 CTGTGTCCTCACATGGTGGAAGG - Intronic
1001511431 5:172325583-172325605 CTGGGTCCTCACGTGGTGAAAGG + Intronic
1001744247 5:174078748-174078770 CTGTGTCCTCACATGGTGGAAGG - Intronic
1003193033 6:3890843-3890865 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1003201459 6:3965088-3965110 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1003253743 6:4456591-4456613 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1003263109 6:4541155-4541177 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1003486745 6:6586734-6586756 CTGTGCCCTCACATGGTGGAAGG - Intergenic
1003833461 6:10040817-10040839 CTGTGTCCTCACTTGGTGCAAGG + Intronic
1003841769 6:10127952-10127974 CTGGGGCTTCAGTTTGTTGATGG - Intronic
1003877037 6:10447073-10447095 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1004190652 6:13460891-13460913 CTGTGTCCTCACATGGTGGAAGG - Intronic
1004233295 6:13851803-13851825 CTGTGTCCTCACTTGGTGGAAGG - Intergenic
1004352846 6:14905389-14905411 CTGTGTCCTCACCTGGTGGAAGG - Intergenic
1004468480 6:15907223-15907245 CTGGAGAATCACTTGATCGAGGG + Intergenic
1005017771 6:21390410-21390432 CCGTGTCCTCACTTGGTGGAAGG - Intergenic
1005169708 6:22968867-22968889 CTGTGTCCTCACCTGGTGGAAGG + Intergenic
1005269863 6:24152273-24152295 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1005827095 6:29639433-29639455 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1006075771 6:31531304-31531326 CTGGGGCATCCCACGGTGGATGG + Exonic
1007470345 6:42086011-42086033 CTGTGTCCTCACATGGTGGAAGG - Intronic
1008438096 6:51499573-51499595 CTGTGTTCTCACTTGGTGGAAGG + Intergenic
1008668232 6:53738752-53738774 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1009304803 6:62075282-62075304 CTGTGTCCTCACATGGTGGAGGG - Intronic
1009727824 6:67557962-67557984 CTGGGACAGCACGTGGGGGAAGG - Intergenic
1009763131 6:68034818-68034840 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1010006974 6:71006257-71006279 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1010359355 6:74974626-74974648 CTACGTCATCACATGGTGGAAGG + Intergenic
1010367595 6:75069850-75069872 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1010507656 6:76680204-76680226 CTGAGTCCTCACCTGGTGGAAGG - Intergenic
1010649474 6:78434565-78434587 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1010986967 6:82435703-82435725 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1011000352 6:82581770-82581792 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1011127355 6:84021438-84021460 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1011214024 6:84985855-84985877 CTGGGCTGTCACTTGGTGGAGGG + Intergenic
1011289938 6:85766374-85766396 CTGGGTCCTCACATGGTAGAAGG + Intergenic
1011811083 6:91133031-91133053 CTGGGGCCTCCGTGGGTGGATGG + Intergenic
1011859605 6:91738264-91738286 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1011945511 6:92896815-92896837 CTAGGGCATCGCTAGGTGGTAGG - Intergenic
1012411381 6:98961898-98961920 CTGTGTCATCTCATGGTGGAAGG - Intergenic
1012926617 6:105274267-105274289 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1013749261 6:113383531-113383553 CTGTGTCTTCACCTGGTGGAAGG + Intergenic
1014335311 6:120126422-120126444 CTGTGTCATCATGTGGTGGAAGG + Intergenic
1014336442 6:120142553-120142575 CTGTGTCCTCACCTGGTGGAAGG - Intergenic
1014642160 6:123926010-123926032 CTGTGTCCTCACATGGTGGAAGG + Intronic
1015169893 6:130240768-130240790 CTGAGTCCTCACATGGTGGAAGG - Intronic
1015684675 6:135846678-135846700 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1016353177 6:143189992-143190014 CTGTGTCCTCACATGGTGGAAGG + Intronic
1017187486 6:151616803-151616825 CTGTGTCCTCACATGGTGGAAGG + Intronic
1017555697 6:155564332-155564354 CTGTGTCATTACATGGTGGAGGG - Intergenic
1017595650 6:156025907-156025929 CTGTGTCCTCACATGGTGGAGGG - Intergenic
1017852345 6:158315790-158315812 CTGTGTCCTCACATGGTGGAAGG + Intronic
1018040602 6:159918461-159918483 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1018334791 6:162775135-162775157 CTGGGTCCCCACATGGTGGAAGG - Intronic
1018520576 6:164645662-164645684 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1018644600 6:165935838-165935860 CTGTGTCATCCCATGGTGGAAGG - Intronic
1018714614 6:166521982-166522004 CTGTGTCCTCACTTGATGGAAGG - Intronic
1019324822 7:432898-432920 CTGGGCCAGCCCTGGGTGGAGGG - Intergenic
1019521374 7:1461911-1461933 GTGGGGTAGCCCTTGGTGGAAGG - Intergenic
1019911009 7:4100581-4100603 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1020220624 7:6233924-6233946 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1021176719 7:17458502-17458524 CTGGGGCATCACTGGGGGCCTGG - Intergenic
1022647614 7:32245794-32245816 CTGTGTCCTCACATGGTGGAAGG + Intronic
1023047414 7:36222740-36222762 CGGGGTCCCCACTTGGTGGAAGG + Intronic
1023224304 7:37952861-37952883 CTGGGTCACCTCTTGGTGGCAGG + Intronic
1023961391 7:44929592-44929614 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1024852787 7:53741026-53741048 CTGTGGCATCAGTAGGTGCAGGG - Intergenic
1024904746 7:54363908-54363930 CTGTGCCTTCACGTGGTGGAAGG + Intergenic
1025002612 7:55329684-55329706 CTGTGTCATCCCGTGGTGGAAGG + Intergenic
1025478871 7:60958005-60958027 CCAGGGCATCTCTTGGTGCAAGG - Intergenic
1026103657 7:67403431-67403453 CTGTGTCATCACATGGTGGAAGG + Intergenic
1026580794 7:71615090-71615112 CTGTGGCAGCTTTTGGTGGAAGG + Intronic
1026590951 7:71695177-71695199 CTGGGGCCTCTCTTGGTGTGGGG - Intronic
1027418163 7:77994406-77994428 CTGTGGCCTCACATGATGGAAGG + Intergenic
1027617649 7:80443650-80443672 CTGTGTCCTCACATGGTGGAAGG + Intronic
1027695728 7:81407823-81407845 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1029547007 7:101215977-101215999 CTGGCGCACGATTTGGTGGATGG + Exonic
1029882179 7:103826159-103826181 CTGTGTCATAACATGGTGGAAGG - Intronic
1030271073 7:107668800-107668822 CTGCGTCCTCACATGGTGGAAGG + Intronic
1030422163 7:109321158-109321180 CTGTGTCCTCACTAGGTGGAAGG + Intergenic
1030776811 7:113543663-113543685 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1031035920 7:116787490-116787512 CTGTGTCATAACATGGTGGAAGG + Intronic
1031213514 7:118860749-118860771 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1031606380 7:123772854-123772876 CTTGTCCCTCACTTGGTGGATGG - Intergenic
1032531852 7:132627687-132627709 CTGTGCCTTCACATGGTGGAAGG - Intronic
1032715758 7:134507788-134507810 CTGGTGCATCACTTGGAGACAGG + Intergenic
1032779755 7:135155621-135155643 CAGGGGCATTAATTGATGGAAGG + Intronic
1033366521 7:140676200-140676222 CTGTGTCATCACATGGTAGAAGG + Intronic
1033787802 7:144755110-144755132 ATGGGCCATCATTTGGGGGATGG + Intronic
1034402708 7:150876089-150876111 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1034530569 7:151693756-151693778 CTGCGTCCTCACATGGTGGAAGG - Intronic
1034864426 7:154628740-154628762 CTGGGGACTCGCTTTGTGGAAGG - Intronic
1034872087 7:154694117-154694139 CTGTGTCCTCGCTTGGTGGAAGG + Intronic
1034888930 7:154822353-154822375 CTGCGTCCTCACATGGTGGAAGG + Intronic
1035461097 7:159039660-159039682 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1036535194 8:9643337-9643359 CTGTGTCATCCCATGGTGGAAGG + Intronic
1038282774 8:26180974-26180996 CTGTGTCCTCACCTGGTGGAAGG - Intergenic
1038358614 8:26854932-26854954 CTGTGTGCTCACTTGGTGGAAGG - Intronic
1038381268 8:27096598-27096620 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1038483361 8:27916993-27917015 CTGTGTCCTCACTTGGTGGGAGG - Intronic
1038725296 8:30076781-30076803 CTGTGTCATCCCATGGTGGAAGG - Intronic
1038757439 8:30354611-30354633 CTGGGTCCTCACATGGTTGAAGG + Intergenic
1039772568 8:40702089-40702111 CTGTGTCATAACATGGTGGAGGG - Intronic
1039785688 8:40832514-40832536 AGGGGGCATCATCTGGTGGAAGG - Intronic
1039883481 8:41641933-41641955 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1040021398 8:42744545-42744567 CTGAGTCCTCACATGGTGGACGG + Intergenic
1040750218 8:50696741-50696763 CTGTGGCATCACTTGACTGATGG + Intronic
1041258209 8:55997485-55997507 CTGTGTCCTCACGTGGTGGAAGG + Intronic
1041617158 8:59920883-59920905 CTGGAGCATCACTTTCAGGAAGG - Intergenic
1042411409 8:68470739-68470761 CTGTGTCCTCACATGGTGGAAGG + Intronic
1042775884 8:72430808-72430830 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1042975035 8:74459145-74459167 CTGTGCCAACACTTGGTGGGTGG + Intronic
1043022429 8:75020500-75020522 CTGTGTCCTCACATGGTGGAGGG + Intronic
1044385822 8:91587277-91587299 CTGTGACTTCACATGGTGGAAGG - Intergenic
1045468870 8:102493479-102493501 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1046308617 8:112403589-112403611 CTGTGTCCTCACATGGTGGAAGG + Intronic
1046471726 8:114683647-114683669 CTGGGTCATAACATGGTGAAAGG + Intergenic
1046932405 8:119854992-119855014 CTGGGGCTGCACAGGGTGGAGGG + Intronic
1047067096 8:121296850-121296872 CTGGGGCATGAACTAGTGGAGGG + Intergenic
1047432862 8:124807665-124807687 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1047530167 8:125667282-125667304 CTGGGGGATCACTTGATGCCAGG - Intergenic
1048465552 8:134662147-134662169 CTGTGTCCTCACATGGTGGAAGG + Intronic
1049254822 8:141608158-141608180 CTGTGGCCTCACATGGTGGATGG - Intergenic
1049323376 8:142009282-142009304 CTGTGCCCTCACATGGTGGATGG - Intergenic
1049410110 8:142470139-142470161 GTGGGGCAGCACGAGGTGGAGGG - Intronic
1050206774 9:3204695-3204717 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1050529530 9:6576306-6576328 CTGTGTCCTCACATGGTGGAAGG + Intronic
1051277279 9:15408939-15408961 CTGTGTCTTCACCTGGTGGAAGG + Intergenic
1051695941 9:19767967-19767989 ATGGGGCATCGCATGGTGAACGG + Intronic
1051701702 9:19831009-19831031 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1051737377 9:20215162-20215184 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1052362066 9:27572765-27572787 CTTGGGCATCACTTGACTGATGG - Intronic
1052378735 9:27746145-27746167 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1053723363 9:40971979-40972001 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1054702233 9:68424399-68424421 CTGTGTCCTCACATGGTGGAAGG + Intronic
1055618210 9:78095112-78095134 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1055804285 9:80075700-80075722 CTCAGACATCACTTGGGGGATGG - Intergenic
1056222955 9:84468041-84468063 CTGTAACCTCACTTGGTGGAAGG - Intergenic
1057043219 9:91862707-91862729 CTGTGTCCTCACATGGTGGAGGG - Intronic
1057673306 9:97114895-97114917 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1057855031 9:98595207-98595229 CTGGGTCCTCACATGGTGGGAGG + Intronic
1058271827 9:102982018-102982040 CTGGGTCCTCACTTGGTGGAAGG - Intergenic
1058600093 9:106659884-106659906 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1058785127 9:108379376-108379398 CTGTGGCCTCACGTGGTGGAAGG - Intergenic
1058890737 9:109358517-109358539 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1058983179 9:110188864-110188886 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1059465147 9:114464452-114464474 CTGTGTCCTCACATGGTGGAAGG + Intronic
1060283196 9:122227469-122227491 CTGGGCCATCACCTGGGGGAGGG + Exonic
1060300070 9:122369900-122369922 CCTGGGCATCACTGGGTGCAGGG - Intergenic
1060371047 9:123071857-123071879 CTGGGGAAACACTTGGTGTATGG + Intronic
1060607767 9:124932828-124932850 CTGTGCCCTCACATGGTGGAAGG + Intronic
1061785666 9:133026522-133026544 CTGTGCCATAACATGGTGGAGGG + Intergenic
1061825282 9:133254567-133254589 CTGGGGCATAAGTTCCTGGAGGG - Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062009193 9:134258194-134258216 CTGGGTCATCCCTTGGAGGCAGG + Intergenic
1062056785 9:134472957-134472979 CTGGGGCCTCACCTGGGAGAGGG - Intergenic
1062262691 9:135670778-135670800 CTTGGTCAGCCCTTGGTGGAGGG + Intergenic
1062387036 9:136316688-136316710 TTGGGGCATCACCCGGTGGTTGG + Intergenic
1062387043 9:136316707-136316729 TTGGGGCGTCGCTTGGTGGCTGG + Intergenic
1062465406 9:136678599-136678621 CTGGGGGATCAAATGGTGGGGGG - Intronic
1062589837 9:137268677-137268699 CTGTGTCATCCCATGGTGGAAGG + Intronic
1062725985 9:138073846-138073868 CTGGGGCATCACTTGGTGGAGGG + Intronic
1203367178 Un_KI270442v1:269211-269233 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185489702 X:511784-511806 CTGTGCCCTCACGTGGTGGAAGG - Intergenic
1185641253 X:1589682-1589704 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185671050 X:1810403-1810425 CTGTGTCCTCACCTGGTGGAAGG - Intergenic
1185808302 X:3080661-3080683 CTGTGTCCTCACATGGTGGAAGG + Intronic
1185842776 X:3408520-3408542 ATGGGTCCTCACATGGTGGAAGG + Intergenic
1185869679 X:3653257-3653279 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185872258 X:3673897-3673919 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185876760 X:3708188-3708210 CTGTGTCCTCACATGGTGGAAGG - Intronic
1186029146 X:5347778-5347800 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186054869 X:5639407-5639429 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186066796 X:5775268-5775290 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1186170547 X:6872009-6872031 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1186178797 X:6952750-6952772 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186211400 X:7253979-7254001 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186228984 X:7432099-7432121 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186236828 X:7521102-7521124 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1186242354 X:7583141-7583163 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186281575 X:7998803-7998825 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186313899 X:8348524-8348546 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186364411 X:8876014-8876036 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186408755 X:9327143-9327165 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186451783 X:9680061-9680083 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186716588 X:12258422-12258444 CTGTGTCATAACATGGTGGAAGG - Intronic
1187471584 X:19574557-19574579 CTGTGCCCTCACGTGGTGGAAGG + Intronic
1188351816 X:29140777-29140799 CTGAGTCCTCACATGGTGGAAGG + Intronic
1188425567 X:30043278-30043300 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1188431950 X:30113575-30113597 CTGTGACATCACATGGTGGAAGG + Intergenic
1188520075 X:31029146-31029168 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1188686299 X:33074683-33074705 CTGGGGCATCACATGGCAGGAGG - Intronic
1189219949 X:39363014-39363036 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1189554201 X:42125509-42125531 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1189721940 X:43928824-43928846 CTGCGTCATCCCATGGTGGAAGG + Intergenic
1190370326 X:49734129-49734151 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1190762347 X:53447001-53447023 CTGTGTCCTCACCTGGTGGAAGG - Intergenic
1191203007 X:57804806-57804828 CTGGGGCCTCTCGTGGTGTAGGG - Intergenic
1191821390 X:65312738-65312760 CTGTGTCCTCACCTGGTGGAAGG + Intergenic
1192171452 X:68857900-68857922 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1193136951 X:77983008-77983030 CTGTGTCCTCACATGGTGGAAGG + Intronic
1193489671 X:82133863-82133885 CAGGGGCATTGCTTAGTGGAGGG - Intergenic
1193891504 X:87051218-87051240 CTGTGGCTTCACATAGTGGAAGG - Intergenic
1194482768 X:94447102-94447124 CTGGCTGATCACTTTGTGGAAGG - Intergenic
1194633248 X:96312391-96312413 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1194736713 X:97521127-97521149 CTGTGCCCTCACATGGTGGAAGG - Intronic
1194780254 X:98015870-98015892 CTGTGTCATCACATGGTGAAAGG + Intergenic
1195007693 X:100702394-100702416 TTGAGGACTCACTTGGTGGAGGG - Intronic
1195292588 X:103443470-103443492 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1195407730 X:104535157-104535179 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1195477561 X:105303994-105304016 CTGGAGCCTCACTTGCTGGCAGG - Intronic
1195941179 X:110169270-110169292 CTGGGGTATCACTGGGTTGATGG - Intronic
1196076740 X:111586080-111586102 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1196323218 X:114368813-114368835 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1196567229 X:117222411-117222433 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1196937710 X:120745973-120745995 CTGTGCCCTCACATGGTGGAGGG - Intergenic
1197405760 X:126047068-126047090 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1197787140 X:130210026-130210048 CTGCGTCCTCACATGGTGGAAGG - Intronic
1198671778 X:139088914-139088936 CTGTGTCCTCACATGGTGGAAGG - Intronic
1198838064 X:140825641-140825663 CTGGGTCATTACATGGTGGAAGG + Intergenic
1198891844 X:141404996-141405018 CTGTGTCCTCACATGGTGGATGG - Intergenic
1200783488 Y:7238050-7238072 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1200788603 Y:7280222-7280244 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1200791646 Y:7304784-7304806 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1200842324 Y:7795392-7795414 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1200944115 Y:8815267-8815289 CTGGGTCCTCACATGGTAGAAGG + Intergenic
1201071509 Y:10151021-10151043 ATGGGTCCTCACATGGTGGAAGG - Intergenic
1201254707 Y:12095894-12095916 CTGTGACGTCACATGGTGGAAGG + Intergenic
1201375903 Y:13318815-13318837 ATGGGGCTTCACATGGTGGCAGG - Intronic