ID: 1062726860

View in Genome Browser
Species Human (GRCh38)
Location 9:138079122-138079144
Sequence TGGGAATCTGTATGTCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 1, 2: 7, 3: 53, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062726860_1062726871 23 Left 1062726860 9:138079122-138079144 CCTGTTAGACATACAGATTCCCA 0: 1
1: 1
2: 7
3: 53
4: 231
Right 1062726871 9:138079168-138079190 GGTGTCTTGGAGATGGATCCAGG No data
1062726860_1062726866 2 Left 1062726860 9:138079122-138079144 CCTGTTAGACATACAGATTCCCA 0: 1
1: 1
2: 7
3: 53
4: 231
Right 1062726866 9:138079147-138079169 CCACTCCCGAGACTGCATCAGGG No data
1062726860_1062726869 10 Left 1062726860 9:138079122-138079144 CCTGTTAGACATACAGATTCCCA 0: 1
1: 1
2: 7
3: 53
4: 231
Right 1062726869 9:138079155-138079177 GAGACTGCATCAGGGTGTCTTGG No data
1062726860_1062726864 1 Left 1062726860 9:138079122-138079144 CCTGTTAGACATACAGATTCCCA 0: 1
1: 1
2: 7
3: 53
4: 231
Right 1062726864 9:138079146-138079168 GCCACTCCCGAGACTGCATCAGG No data
1062726860_1062726870 16 Left 1062726860 9:138079122-138079144 CCTGTTAGACATACAGATTCCCA 0: 1
1: 1
2: 7
3: 53
4: 231
Right 1062726870 9:138079161-138079183 GCATCAGGGTGTCTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062726860 Original CRISPR TGGGAATCTGTATGTCTAAC AGG (reversed) Intronic
901442294 1:9285747-9285769 TGGGAGTCTGTAGGTCTAACGGG - Intergenic
902836090 1:19047652-19047674 TGGGAATCTGTATTTGTAATAGG - Intergenic
904109275 1:28112722-28112744 CGGGAATCTGTATTTCTAACAGG + Intergenic
907796960 1:57727531-57727553 TGGGATTCTGTCTGTATCACTGG + Intronic
908305878 1:62815560-62815582 TGTGAATCTGTATTTCCATCTGG + Intronic
908672092 1:66559212-66559234 TGTGATTCTGCATTTCTAACAGG + Intronic
911625594 1:100120551-100120573 TAAGAATCTGCATTTCTAACAGG - Intronic
913702360 1:121385314-121385336 TGGGACTCTGGATGCCTGACTGG + Intronic
914042923 1:144065810-144065832 TGGGACTCTGGATGCCTGACTGG + Intergenic
914135163 1:144894678-144894700 TGGGACTCTGGATGCCTGACTGG - Intronic
915482260 1:156194925-156194947 TGAAATTCTGTATTTCTAACAGG + Intronic
917220391 1:172722356-172722378 TGGAAATTTGTCTGTGTAACTGG + Intergenic
917599989 1:176564179-176564201 TGAGATTCTGCATTTCTAACAGG + Intronic
918480834 1:184974840-184974862 TGAGATTTTGTATTTCTAACAGG - Intergenic
920009395 1:202856913-202856935 TGGTAATCTGTATGTTCAACAGG - Intergenic
920489787 1:206404056-206404078 TGGGACTCTGGATGCCTGACTGG + Intronic
921014214 1:211172476-211172498 TGTAAATCTGTATTTCTACCTGG + Intergenic
921301000 1:213751490-213751512 GGGGACTCTGGATGTCTAATTGG - Intergenic
922168203 1:223133449-223133471 TGAGAGTCTGCATTTCTAACGGG + Intronic
924426431 1:243954533-243954555 TAGGAATCTGGATGTCTAGAGGG + Intergenic
1063433935 10:6015473-6015495 CAGGAATCTGTATTTCTATCAGG - Intronic
1063511552 10:6649320-6649342 TGGGATTCTGCATTTCCAACAGG + Intergenic
1064285424 10:13986972-13986994 TGGGAATTTGCATTTCAAACAGG + Intronic
1070970071 10:80556486-80556508 TGGGAATCTGTAGATCAACCTGG + Intronic
1074450589 10:113556308-113556330 TGGGAATCTGTATCTTTAATGGG - Intronic
1074585458 10:114764042-114764064 TGGGAATCTATATTTTTAAAAGG + Intergenic
1075307390 10:121380202-121380224 TGAGATTCTGCTTGTCTAACAGG - Intergenic
1079315003 11:19400072-19400094 TGGGAAGCTGTAAGTCTTTCGGG + Intronic
1079428931 11:20370072-20370094 TTGGAATCTGTATTTTTAGCAGG + Intronic
1080758913 11:35228859-35228881 TGAGAATTTGTATTTCTAACAGG + Intronic
1082861321 11:57859340-57859362 TGAGATTCTGTATTTCTAACAGG + Intergenic
1087586194 11:100125011-100125033 TGGAAATTTGCATTTCTAACAGG + Intronic
1089000644 11:115049480-115049502 TGGGTATCTGTATACATAACTGG + Intergenic
1090016594 11:123091700-123091722 TGGAAATTTGTCTGTGTAACTGG + Intronic
1090412085 11:126516232-126516254 TAGGAAGCTTTATTTCTAACGGG + Intronic
1093101444 12:15034416-15034438 TGGAAATCTGTCTGTGTAACTGG + Intergenic
1095344718 12:41136527-41136549 AGGGAAGATGTATGTCAAACAGG - Intergenic
1097023604 12:56037472-56037494 TGGGAGGCGGTAGGTCTAACAGG - Exonic
1098384117 12:69900511-69900533 TGAGAATATGCATTTCTAACAGG + Intronic
1099246993 12:80203879-80203901 TGGGAATCTGTGCTTCTAATAGG + Intergenic
1099421640 12:82469152-82469174 TGGAAATCTGTATTTCTGCCTGG + Intronic
1102367016 12:112346321-112346343 TGGGAATCTGCATGTTTAACAGG + Intronic
1103496886 12:121369751-121369773 TGGGGTTGTGAATGTCTAACAGG + Intronic
1104623160 12:130333340-130333362 TGGGAATCTGCATTTCTATCAGG + Intergenic
1104738480 12:131154658-131154680 TGGGATTCTGCATTTCTTACAGG + Intergenic
1104794305 12:131506472-131506494 TGGGACTCTGCATTTCTGACAGG - Intergenic
1108190456 13:47933105-47933127 TAGGAATCTGTATGCTTAACAGG + Intergenic
1111420239 13:88001054-88001076 TGGGACTCTGTGTGTCTTAGTGG + Intergenic
1111868270 13:93797206-93797228 TGAGATTCTGCATTTCTAACAGG + Intronic
1111958045 13:94779707-94779729 TGAGAATTTGTTTTTCTAACAGG + Intergenic
1112373717 13:98819199-98819221 TGGGAATCTATATTTGTAGCAGG + Intronic
1112555554 13:100465131-100465153 TGGGAATCTGTATTTTCACCAGG - Intronic
1114124852 14:19713439-19713461 TGGGCATCTCTATGCCAAACTGG - Intergenic
1115807845 14:37072364-37072386 TGGGAAACTGTATCTCTACCAGG + Intronic
1116029648 14:39555309-39555331 TGGAAATATGTCTGTGTAACTGG + Intergenic
1117200724 14:53387219-53387241 TGAGATTCTGTATTTCTAATAGG + Intergenic
1119631840 14:76238874-76238896 TGAGAATTTGCATTTCTAACAGG + Intronic
1119972718 14:78990245-78990267 TGGGAAACTGCCTCTCTAACAGG + Intronic
1120472288 14:84940692-84940714 GGAGAATCTGCATTTCTAACAGG + Intergenic
1121345156 14:93130106-93130128 TGAGACTCTGCATGTCTAGCAGG + Intergenic
1123479005 15:20613926-20613948 TGTGGAACTTTATGTCTAACTGG + Intergenic
1123639007 15:22386459-22386481 TGTGGAACTTTATGTCTAACTGG - Intergenic
1125791896 15:42373321-42373343 TGGGAATCTGTATTTTCAACTGG + Intronic
1126014846 15:44340618-44340640 TAAGAATTTGCATGTCTAACAGG - Intronic
1126124552 15:45283692-45283714 TGAGACTCTGCATGTCTAGCAGG - Intergenic
1126293906 15:47115395-47115417 CAGGAATTTGTATTTCTAACAGG - Intergenic
1127095411 15:55507948-55507970 TGGGAATTTGCATTTCTAACAGG - Intronic
1127402881 15:58608332-58608354 TGATAATCTGTATTACTAACTGG + Intronic
1127428582 15:58880460-58880482 TGAGAATTTGCATTTCTAACAGG - Intronic
1127654628 15:61044769-61044791 TGAGATTCTGTATTTCTAGCAGG - Intronic
1127775164 15:62258836-62258858 TGGAAATTTGTTTGTATAACTGG - Intergenic
1127797111 15:62448051-62448073 CAGGAATCTGTATTTCCAACAGG + Intronic
1129159554 15:73739739-73739761 TGGGCATCTTCATGTCTAAGAGG + Exonic
1129448371 15:75634701-75634723 TGAGAATTTGCATTTCTAACAGG - Intergenic
1129605741 15:77024194-77024216 TGAGAATCTGTATTTCTAACAGG + Intronic
1129782741 15:78284566-78284588 TGGGATTCTGCATTTCTAACAGG - Intronic
1129880287 15:79002090-79002112 TGAGAGTCTGCATTTCTAACAGG + Intronic
1130097233 15:80864915-80864937 TGAGAACCTGTGTTTCTAACAGG + Intronic
1130234633 15:82122945-82122967 TGAGAATCTGCATGACTCACAGG + Intergenic
1130647218 15:85739242-85739264 TGAGCATTTGTATGTCTAATGGG - Intronic
1131433683 15:92406306-92406328 TGAGAATTTGCATCTCTAACAGG + Intronic
1131946232 15:97625037-97625059 TGAGAATGTGTGTGTCTAATGGG + Intergenic
1135633210 16:24052280-24052302 TGAGAATTTGAATTTCTAACAGG + Intronic
1137604644 16:49779442-49779464 TGAGATTCTGCATTTCTAACAGG - Intronic
1138009567 16:53365119-53365141 CAGGAATTTGCATGTCTAACAGG - Intergenic
1139021198 16:62751945-62751967 TGGGTAGCTGTATATATAACTGG + Intergenic
1140966615 16:79972536-79972558 TGTGAATCTGCATTTCTAACAGG - Intergenic
1141066946 16:80921651-80921673 AGAGAATCTGCATCTCTAACAGG + Intergenic
1141807922 16:86354245-86354267 TGGGACTCTGCATTTCTATCAGG - Intergenic
1143417951 17:6763730-6763752 TGAGATTCTGCATTTCTAACAGG - Intronic
1144038820 17:11390478-11390500 TGGGAGTCTGCATTTCTCACTGG - Intronic
1144224133 17:13128198-13128220 TGAGAATCTTTGTGTCCAACAGG - Intergenic
1144461429 17:15461607-15461629 CAGGAATCTGCATCTCTAACAGG + Intronic
1145191612 17:20845128-20845150 AGTGAATCTGTATTTTTAACTGG - Intronic
1148026790 17:44594217-44594239 TGAGGATGTGTATGTGTAACAGG + Intergenic
1149455537 17:56785234-56785256 TGAGAGTTTGCATGTCTAACAGG + Intergenic
1152509259 17:80774170-80774192 TGGGAGTCTGGATGTCAAGCTGG + Intronic
1153125215 18:1783469-1783491 TGGGAACATGTATATCTAACGGG - Intergenic
1153517311 18:5916201-5916223 TGAGATTCTGCAGGTCTAACAGG - Intergenic
1154425160 18:14266288-14266310 AGGAAATCTGTTTGTATAACAGG + Intergenic
1154426773 18:14278095-14278117 TGGGATTCTGGATGTCTATTGGG + Intergenic
1154432853 18:14321527-14321549 AGGAAATCTGTTTGTATAACAGG + Intergenic
1156360802 18:36382933-36382955 TGGAAATCTGTCTGTGTAACTGG + Intronic
1156864351 18:41872495-41872517 TGAGAATTTGCATTTCTAACAGG + Intergenic
1156966256 18:43097207-43097229 TGAGCATTTGTATTTCTAACAGG + Intronic
1157119981 18:44900184-44900206 TGAGAACCTGCATTTCTAACAGG - Intronic
1157782442 18:50451704-50451726 TGGAAATTTGTCTGTGTAACTGG - Intergenic
1158876402 18:61738425-61738447 TAGGAATCTGTATTTTTAAAAGG + Intergenic
1160362200 18:78293517-78293539 TGGGAGTCTGCATTTCTGACAGG - Intergenic
1167572922 19:50301206-50301228 TGGGAATCTGCACTTATAACGGG - Intronic
1168721639 19:58557835-58557857 TGGGAATCTCTGAGTCAAACGGG - Intronic
925221431 2:2144373-2144395 TGGCCATCTGTATGGCTCACAGG + Intronic
925459630 2:4049283-4049305 TGGAAATCTGTCTGTGTAATTGG - Intergenic
925918291 2:8622872-8622894 TGTGTGTCTGTCTGTCTAACGGG - Intergenic
926580300 2:14627434-14627456 TGGGAATCTGCATTTTTATCAGG + Intergenic
927306419 2:21578733-21578755 TGGCAATATTTATGTCTAAATGG + Intergenic
927663431 2:25012270-25012292 TGGGTATATGTGTGTCTAAGTGG + Intergenic
928483341 2:31705824-31705846 TGGGAATCTGAATATTTAACTGG + Intergenic
930373482 2:50534424-50534446 TGGGAAACTTTTTGTCTAATTGG - Intronic
930658482 2:54030484-54030506 TGGAAACCTGTCTGTCTAACTGG + Intronic
931287927 2:60848229-60848251 TGGAAATCTGTCTGTGTAACGGG - Intergenic
931936748 2:67206681-67206703 TGAGATTCTGCATTTCTAACAGG + Intergenic
933839749 2:86276815-86276837 TGAGATTCTGCATTTCTAACAGG - Intronic
934907540 2:98218427-98218449 TAGGAATCTGTGTTTTTAACAGG + Intronic
934995185 2:98951041-98951063 TGGGAACCTATAGGACTAACTGG + Intergenic
937858128 2:126687390-126687412 TGAGAATTTCTATTTCTAACAGG + Intronic
939641077 2:144640576-144640598 TGAGAATTTGTATTTGTAACAGG + Intergenic
940000159 2:148959588-148959610 TGGGAATCTGTGTCTCACACTGG - Intronic
941658531 2:168170563-168170585 TGAGAATCTGCATTTCTAGCAGG + Intronic
942877896 2:180824506-180824528 TTGGAAACAGTGTGTCTAACTGG - Intergenic
945281939 2:208043828-208043850 TTGGAAACTGAATGTATAACTGG - Intergenic
945631418 2:212282732-212282754 TGGGAATTTGTATTTTTAAGTGG + Intronic
946217056 2:218192548-218192570 TGGGAACCTATATGATTAACAGG + Intergenic
947553012 2:231060969-231060991 CGAGAATGTGTATTTCTAACAGG + Intronic
948829107 2:240588987-240589009 TGGAAATCTGTTTCTCTAGCAGG - Intronic
1168813333 20:720454-720476 TGAGAATGTGTATGTCTTACAGG + Intergenic
1168850197 20:971292-971314 TGAGAATTTGTATTTCTAACAGG + Intronic
1168875612 20:1170167-1170189 TGAGATTCTGCATGTGTAACAGG - Intronic
1169122876 20:3107808-3107830 TGGGGATCTGCATTTCTAACAGG - Exonic
1169699003 20:8425508-8425530 TGAGATTCTGTATCTCAAACTGG + Intronic
1170609712 20:17902565-17902587 TGAGAATGTGCATTTCTAACAGG - Intergenic
1171383842 20:24753614-24753636 TGGGATTCTGCATTTCTAACCGG - Intergenic
1172516582 20:35538481-35538503 TGGGATTCTGCATTTCTAACAGG + Intergenic
1173199145 20:40941566-40941588 CAGGAATTTGCATGTCTAACAGG - Intergenic
1173563146 20:44020647-44020669 TGAGAATCTGCATCTCTAACAGG - Intronic
1173749586 20:45466938-45466960 TGAGAATTTGCATTTCTAACAGG - Intergenic
1174339257 20:49885901-49885923 TGGGAATCTGCAGATCTAACAGG - Intronic
1180457912 22:15528614-15528636 TGGGCATCTCTATGCCAAACTGG + Exonic
1180868030 22:19130828-19130850 TGGAAATCTGTCTGTGTAACTGG + Exonic
1182171379 22:28233553-28233575 TTGGAATACATATGTCTAACTGG - Intronic
1182734167 22:32519206-32519228 TGCGATTCTGCATTTCTAACGGG + Intronic
1183209653 22:36443022-36443044 TGAGAATGTGTATTTCCAACAGG + Intergenic
949399934 3:3655682-3655704 TGTAAATCTAAATGTCTAACAGG + Intergenic
949841190 3:8321852-8321874 TGGGAATCTGTATTTCTAACAGG - Intergenic
950158454 3:10741537-10741559 TGAGAATATGCATTTCTAACAGG + Intergenic
950888367 3:16380618-16380640 TGAGAATTTGCATTTCTAACAGG - Intronic
951458959 3:22928324-22928346 TGGAAATTTGTCTGTGTAACTGG - Intergenic
951624231 3:24642604-24642626 TGATAATCTGCATGTCTAACAGG + Intergenic
951791524 3:26490822-26490844 TGATAATTTGTATGTCTAAAAGG - Intergenic
951800803 3:26593992-26594014 TGGGAAACTGTATATCTGATAGG - Intergenic
952156670 3:30650760-30650782 TGAGAATCTGCATTTATAACAGG - Intronic
953308482 3:41853211-41853233 TGAGAATTTGCATTTCTAACAGG + Intronic
955199885 3:56841828-56841850 TGGGAATTTGTATGTGTATGTGG - Intronic
955488549 3:59459626-59459648 TGAGATTCTGCATTTCTAACAGG - Intergenic
956200775 3:66703204-66703226 TGAGATTCTGCATCTCTAACAGG + Intergenic
956422973 3:69103814-69103836 TGGGAATCTGTATTTTAAACAGG - Intronic
956502964 3:69907311-69907333 TGGGGCTCTGTGTGTCAAACTGG + Intronic
957319394 3:78609550-78609572 TGGAAATCTGTATAACTACCTGG - Intronic
959244972 3:103854515-103854537 TTCTAATCTCTATGTCTAACAGG - Intergenic
960100298 3:113735298-113735320 TGAGAATCTGAATTTTTAACTGG - Intronic
960573559 3:119207846-119207868 TGAGATTGTTTATGTCTAACAGG - Intergenic
961546766 3:127639678-127639700 TGGGACCCTGAATGTCTCACAGG + Intronic
961670532 3:128525168-128525190 GGGGAATCTCTATGTCAGACAGG + Intergenic
964285161 3:155109743-155109765 TGGGCATCCGTGTGTCTAAAAGG + Intronic
964665884 3:159171476-159171498 TGAGAATTTGTACTTCTAACAGG + Intronic
966237196 3:177715083-177715105 GAGGAAGCTGTATGTCTAAACGG - Intergenic
966845438 3:184125477-184125499 TGGGCGTCTGCATTTCTAACAGG + Intergenic
970116465 4:12702232-12702254 TAGGACCCTGTATGTTTAACAGG - Intergenic
970534230 4:17012702-17012724 TGGGAATTTAAATGTCTAAGAGG - Intergenic
971181671 4:24334115-24334137 TGGGATCCTGTATTTCTAACAGG + Intergenic
976750521 4:88447623-88447645 TGGAAATCTGTCAGTGTAACTGG - Intergenic
978143688 4:105347352-105347374 TGAGATTCTGTATTTCTGACAGG - Intergenic
980498831 4:133621874-133621896 TGGGAATGTATATTTCTAAGAGG - Intergenic
980615579 4:135219170-135219192 TGTGATTCTGTTTCTCTAACTGG - Intergenic
981144732 4:141311314-141311336 AGGGAATCAGTATTTTTAACAGG - Intergenic
982639790 4:157944222-157944244 TGGGAATCTGTATGTCAAAAGGG - Intergenic
984389206 4:179107039-179107061 TTGAAATCTGTATGTCTAAAAGG + Intergenic
984457805 4:179993098-179993120 TGGGTATCTTTATCTTTAACTGG - Intergenic
985055744 4:186034313-186034335 TGGGAATCTGTGTGTGTATCAGG - Intergenic
985055751 4:186034358-186034380 TGGGAATCTGTGTGTGCATCAGG - Intergenic
985055805 4:186034673-186034695 TGGGAATCCGTGTGTGTATCAGG - Intergenic
985055836 4:186034853-186034875 TGGGAATCTGAGTGTGTATCAGG - Intergenic
985055859 4:186034988-186035010 TGGGAATCTGTGTGTGTATCAGG - Intergenic
985097622 4:186428564-186428586 TGGAAATCTATCTGTGTAACTGG - Intronic
985145512 4:186890597-186890619 GGAGAATCTTTATGTCTAGCTGG + Intergenic
987551538 5:19388703-19388725 TGGGGAACTGTATGCCTAGCAGG - Intergenic
988527178 5:31997546-31997568 TGGGAAACTGTCTATCTGACAGG - Intronic
988977060 5:36526173-36526195 TGGGAATTTGTATCTTTAGCAGG - Intergenic
991592228 5:68265140-68265162 TGGGATTCTGCATTTCCAACAGG - Intronic
991595749 5:68303616-68303638 TGTGAATTTGTACTTCTAACAGG - Intergenic
991721220 5:69495386-69495408 TGGGATTCTGCCTTTCTAACAGG + Intronic
992103172 5:73426813-73426835 TGGAAATCTGCAGTTCTAACAGG - Intergenic
994401935 5:99291002-99291024 TTGGAAACTGGATGTCTTACGGG + Intergenic
995425928 5:112022755-112022777 TGGGAATCTGAAGGTCTAGTAGG - Intergenic
995849606 5:116531557-116531579 TGGGAATCACTATATCTAACAGG - Intronic
996483201 5:123999001-123999023 TGGGAAGCAGTATGCCTAATGGG + Intergenic
997644405 5:135471489-135471511 TGGGCATCTGTCTGTCTATCGGG + Intergenic
998244023 5:140479656-140479678 TGGGAATATACATGTATAACAGG - Intronic
998559322 5:143156477-143156499 TGAGATTCTGTAGATCTAACAGG - Intronic
999527064 5:152418462-152418484 TGAGATTCTGCAAGTCTAACAGG - Intronic
1000191157 5:158912188-158912210 TGGGAATCTTTGTGTCCACCAGG - Intronic
1000681239 5:164187627-164187649 TGAGAATTTGCATTTCTAACAGG - Intergenic
1000937351 5:167318733-167318755 AGGGAACCTATATTTCTAACTGG - Intronic
1001716579 5:173821275-173821297 TGAGAATTTGCATTTCTAACAGG + Intergenic
1003638347 6:7855306-7855328 TGAGAATCTGCATTTCTAACAGG - Intronic
1003929542 6:10910580-10910602 TGGGAATCTGGCTGAGTAACTGG + Intronic
1005594493 6:27366409-27366431 TGGGAATCAGAATTTCTATCTGG - Intergenic
1006178769 6:32140821-32140843 TGGAAATCTGTCTGTGTAACTGG + Intergenic
1007176395 6:39900692-39900714 TGAGATTCTGCATTTCTAACAGG + Intronic
1007349277 6:41256888-41256910 TGGAAATCTGTCTGTGTAACTGG - Intergenic
1007796245 6:44350278-44350300 TGGGAATCTGGAAGTGGAACTGG + Intronic
1007796267 6:44350461-44350483 TGAGAATCTGTATTTTTAACAGG + Intronic
1007820056 6:44554527-44554549 TGAGAATGTGCATTTCTAACAGG + Intergenic
1008937590 6:57008428-57008450 TGGAAATCTGTCTGTGTAACTGG + Intronic
1011542944 6:88452228-88452250 TGGTAAGATGTAAGTCTAACAGG - Intergenic
1011938424 6:92812098-92812120 TGAGATTCTGCATTTCTAACAGG + Intergenic
1011971051 6:93223445-93223467 GAGGAATTTATATGTCTAACAGG - Intergenic
1014851999 6:126352035-126352057 TGAGAATCTGTATTTCTAGCAGG + Intergenic
1015093816 6:129390269-129390291 TGAGAATCTGCATTTCTAATGGG + Intronic
1015268365 6:131313060-131313082 TGAGGTTCTGTATTTCTAACAGG - Intergenic
1017817936 6:158028496-158028518 CAGGAATCTGCATGTCTAACAGG + Intronic
1019146984 6:169981915-169981937 TGGGAATCTGGATCACTCACAGG + Intergenic
1021662912 7:22938805-22938827 TGGAAACCTGTATTTCTAACGGG - Intergenic
1022130050 7:27396747-27396769 TGAGAGTCTGCATGTCTAATGGG + Intergenic
1022272533 7:28823655-28823677 AGGGAATCAGTAACTCTAACTGG + Exonic
1023125642 7:36951603-36951625 TGAGAATCTGCATTTCTAGCAGG + Intronic
1024047498 7:45595254-45595276 TGGTAATCTGCATTCCTAACAGG - Intronic
1024376428 7:48643866-48643888 TGTGATTCTGCATGTCTAACAGG - Intronic
1026067155 7:67084805-67084827 TGAGAATGTGCATTTCTAACAGG + Intronic
1026343418 7:69453549-69453571 TGGGAATGTGTATGTTTAACTGG - Intergenic
1026709778 7:72727522-72727544 TGAGAATGTGCATTTCTAACAGG - Intronic
1028351826 7:89858499-89858521 TGGAAAACTGTATATCTATCAGG - Intergenic
1028601458 7:92605251-92605273 TTGGAAACTGGATGTCTTACTGG - Exonic
1030653767 7:112143833-112143855 AGGGAATGTGTAAGTCTAAAGGG - Intronic
1030803968 7:113890325-113890347 TGGGAATCTGCATTTTTAACTGG + Intronic
1030803975 7:113890413-113890435 TGGGAATCTGCATTTTTAACTGG + Intronic
1031013838 7:116551112-116551134 TGGGGATCTGTATTTTTACCAGG - Intronic
1032913567 7:136461731-136461753 TGAGAATATGTATTTCTAACAGG + Intergenic
1033357105 7:140608857-140608879 CAGGAATCTGCATGTCTGACAGG - Intronic
1034095037 7:148399973-148399995 TGGGCATCTGTATTTCTAACAGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1040990930 8:53348348-53348370 TGGGAATTTGTCTGTGTAACTGG + Intergenic
1041814460 8:61952912-61952934 TGGGAATCTGAATGAATAAGTGG - Intergenic
1041882907 8:62773041-62773063 TGGCAAACTGTATGTCTGACAGG - Intronic
1042346046 8:67729129-67729151 TGGGACTCTGCATTTCTAATGGG - Intronic
1045125092 8:99080441-99080463 TGGCACTTTATATGTCTAACTGG + Intronic
1045209905 8:100086415-100086437 AGGGAATTTGCATTTCTAACAGG - Intronic
1047082223 8:121475664-121475686 TGGGAATTTATTTGCCTAACTGG + Intergenic
1047963661 8:130029344-130029366 TGGAAATCTGTATTTTAAACAGG - Intergenic
1050737603 9:8781859-8781881 TGTCACTCTGTATGCCTAACAGG + Intronic
1051678905 9:19586946-19586968 TGGAACTCTGAATGTCTAAGAGG + Intronic
1052378999 9:27749880-27749902 TGAGATTCTGCATTTCTAACAGG - Intergenic
1053180578 9:35965039-35965061 CGGGAATATGTATGTATACCAGG - Intergenic
1054784154 9:69194807-69194829 TGAGATTCTGTATTTTTAACAGG + Intronic
1055027794 9:71740944-71740966 AGAGAATTTGTATTTCTAACAGG + Intronic
1055158735 9:73097626-73097648 TGGAAATCTGTCTATCTAACTGG - Intergenic
1055774828 9:79755912-79755934 TGTGAATTTGCATTTCTAACAGG - Intergenic
1057611162 9:96544992-96545014 TGAGAATTTGCATTTCTAACAGG - Intronic
1059204965 9:112456000-112456022 TGAGATTCTGCATGTCTGACAGG + Intronic
1059617342 9:115965435-115965457 TAGGAATCTGTGTTTCTACCAGG - Intergenic
1061695239 9:132368640-132368662 TGGAAATGTGTCTGTGTAACTGG + Intergenic
1061888355 9:133604727-133604749 TGGGAACCTGCATTTCTCACGGG + Intergenic
1062726860 9:138079122-138079144 TGGGAATCTGTATGTCTAACAGG - Intronic
1185795423 X:2960420-2960442 TGGACATCTTTATGTCTTACAGG - Exonic
1187011680 X:15286100-15286122 TGTGACTCTGCATGTCTAGCAGG - Intronic
1187506574 X:19883209-19883231 AGAGAATCTGTATCTCTAACGGG + Intronic
1187714643 X:22090955-22090977 TGAGAATCTATATTTTTAACAGG + Intronic
1189051414 X:37649651-37649673 TGGGAATTTGAATTTCTATCAGG + Intronic
1189466870 X:41284186-41284208 TGAGAATCTGCATTTCTATCAGG + Intergenic
1189743493 X:44145484-44145506 TGGGAAGCTGTTTGTCTGAAAGG + Intergenic
1190889961 X:54559174-54559196 TTAGAATTTGTATTTCTAACAGG + Intronic
1192404509 X:70870870-70870892 TGGGCATCTGTATTTTTCACAGG + Intronic
1192692026 X:73374190-73374212 TGGGAATCTGTGTGCCTGAGTGG + Intergenic
1195296062 X:103478755-103478777 TGGAAATTTGTCTGTGTAACTGG + Intergenic
1197182887 X:123555624-123555646 CCAGAATCTGCATGTCTAACGGG - Intergenic
1197588671 X:128382465-128382487 TTGAAATCAGTATGTCTAAAAGG + Intergenic
1199296598 X:146165931-146165953 TGAGAATTTGTATTTCTAACAGG + Intergenic
1199763929 X:150926950-150926972 TGGGAAAATGTATGTCTTCCTGG - Intergenic
1200787946 Y:7275279-7275301 AGGGACTCTGTATGGCTAAGTGG + Intergenic
1200836054 Y:7732459-7732481 TGAGAATTTGCATTTCTAACAGG - Intergenic
1200865173 Y:8035886-8035908 TGGGAACCTTTATGTATCACTGG + Intergenic
1200895822 Y:8375086-8375108 TGGGAATTTTGATGTCTACCTGG - Intergenic
1201623991 Y:15993176-15993198 TTAGAATCTGTATTTCTAACAGG + Intergenic