ID: 1062728332

View in Genome Browser
Species Human (GRCh38)
Location 9:138092324-138092346
Sequence GCAGTCTGTAGGCCTACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062728327_1062728332 16 Left 1062728327 9:138092285-138092307 CCTGGTCGTCAACCACATAAGGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1062728332 9:138092324-138092346 GCAGTCTGTAGGCCTACCCCTGG No data
1062728325_1062728332 17 Left 1062728325 9:138092284-138092306 CCCTGGTCGTCAACCACATAAGG 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1062728332 9:138092324-138092346 GCAGTCTGTAGGCCTACCCCTGG No data
1062728328_1062728332 4 Left 1062728328 9:138092297-138092319 CCACATAAGGCACACAATCCCAG 0: 1
1: 0
2: 13
3: 214
4: 413
Right 1062728332 9:138092324-138092346 GCAGTCTGTAGGCCTACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062728332 Original CRISPR GCAGTCTGTAGGCCTACCCC TGG Intronic
No off target data available for this crispr