ID: 1062728672

View in Genome Browser
Species Human (GRCh38)
Location 9:138096211-138096233
Sequence CAATGTGATCACAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062728670_1062728672 -4 Left 1062728670 9:138096192-138096214 CCAGTCTGAGAGGGAAAGACAAT 0: 1
1: 0
2: 1
3: 17
4: 198
Right 1062728672 9:138096211-138096233 CAATGTGATCACAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062728672 Original CRISPR CAATGTGATCACAGAGAGGA AGG Intronic
No off target data available for this crispr