ID: 1062729003

View in Genome Browser
Species Human (GRCh38)
Location 9:138097948-138097970
Sequence AGGGCCCGTGCAGCACCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 165}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062729003_1062729013 18 Left 1062729003 9:138097948-138097970 CCAGAGGGTGCTGCACGGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1062729013 9:138097989-138098011 CCAGAGCCACTGGCAGCATCGGG No data
1062729003_1062729005 -6 Left 1062729003 9:138097948-138097970 CCAGAGGGTGCTGCACGGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1062729005 9:138097965-138097987 GGCCCTTCCCAGTCTGGACAAGG No data
1062729003_1062729014 19 Left 1062729003 9:138097948-138097970 CCAGAGGGTGCTGCACGGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1062729014 9:138097990-138098012 CAGAGCCACTGGCAGCATCGGGG No data
1062729003_1062729010 8 Left 1062729003 9:138097948-138097970 CCAGAGGGTGCTGCACGGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1062729010 9:138097979-138098001 TGGACAAGGTCCAGAGCCACTGG No data
1062729003_1062729015 20 Left 1062729003 9:138097948-138097970 CCAGAGGGTGCTGCACGGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1062729015 9:138097991-138098013 AGAGCCACTGGCAGCATCGGGGG No data
1062729003_1062729017 26 Left 1062729003 9:138097948-138097970 CCAGAGGGTGCTGCACGGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1062729017 9:138097997-138098019 ACTGGCAGCATCGGGGGCCCTGG No data
1062729003_1062729018 27 Left 1062729003 9:138097948-138097970 CCAGAGGGTGCTGCACGGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1062729018 9:138097998-138098020 CTGGCAGCATCGGGGGCCCTGGG No data
1062729003_1062729011 17 Left 1062729003 9:138097948-138097970 CCAGAGGGTGCTGCACGGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1062729011 9:138097988-138098010 TCCAGAGCCACTGGCAGCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062729003 Original CRISPR AGGGCCCGTGCAGCACCCTC TGG (reversed) Intronic
900254875 1:1692844-1692866 AGGGCCCGAGCAGAACCAACGGG - Intronic
900263623 1:1746119-1746141 AGGGCCCGAGCAGAACCAACGGG - Intergenic
903446426 1:23425047-23425069 AGGGCCCCTGGGACACCCTCGGG - Intergenic
903515558 1:23908697-23908719 AAGGTCAGTGAAGCACCCTCTGG + Intronic
904701562 1:32361483-32361505 TGGGCACGTGCAGCAGCGTCAGG + Exonic
906746854 1:48228286-48228308 AGGGCCTGTGCAGCATCTCCAGG - Intronic
907779102 1:57548724-57548746 AGGCCCAGTGCCGTACCCTCTGG - Intronic
909082848 1:71134603-71134625 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
909538077 1:76760609-76760631 AGGGTCAGTGCAGGACCCTGGGG + Intergenic
909622509 1:77683563-77683585 GCGGCCCGTGCAGCGCCCGCGGG + Intergenic
910458278 1:87421497-87421519 AGAGCCAGTCCAGCACCCTGTGG + Intergenic
911826850 1:102497990-102498012 TGGTCTCCTGCAGCACCCTCAGG + Intergenic
912797413 1:112701374-112701396 AGGGCCCGTGCCACCACCTCGGG + Exonic
915410487 1:155697821-155697843 TGGTCTCCTGCAGCACCCTCAGG - Intronic
915597515 1:156904033-156904055 AGGGCCCCTGCTGCACCTTGAGG + Intronic
918999635 1:191813771-191813793 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
924733008 1:246729318-246729340 TGGTCTCCTGCAGCACCCTCAGG - Intronic
1066472399 10:35711902-35711924 AAGGGCCGTTCAGCACCTTCGGG - Intergenic
1067088159 10:43253637-43253659 AGGGCCCCTAGAGCCCCCTCTGG - Intronic
1067224546 10:44367119-44367141 AGGCCCTGGGCAGCAGCCTCTGG - Intergenic
1067660496 10:48233519-48233541 AGGGCCTGGGCAGCCCTCTCAGG - Intronic
1068776573 10:60874021-60874043 AGGGCCTGAGCAGCACCTGCTGG + Intronic
1069072834 10:64007298-64007320 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
1070248383 10:74752621-74752643 AGGGCTTCTTCAGCACCCTCTGG + Intergenic
1074759505 10:116655829-116655851 AGGACCCGGGCAGCATCCTGCGG + Intergenic
1075411623 10:122232711-122232733 CAGGCCCGTGGACCACCCTCGGG - Intronic
1075728449 10:124622618-124622640 AGGGCCAGTCCAGCACCCCAGGG + Exonic
1076444248 10:130500926-130500948 ACGGCCCCTGGAGCACCCTGTGG - Intergenic
1076818260 10:132925225-132925247 AGGGCCCGTGTAGCACAGACCGG - Intronic
1076892296 10:133291218-133291240 AGGGCGCGTGCTGCCCTCTCTGG - Intronic
1077344567 11:2040277-2040299 AGAGCCCATGCACCTCCCTCTGG - Intergenic
1083099270 11:60285945-60285967 TGGTCTCCTGCAGCACCCTCAGG - Intronic
1083318037 11:61828289-61828311 AGGGCCCGGGCTGCACACACCGG + Exonic
1083404607 11:62447964-62447986 AGGGCCTGTGGAGCCCTCTCAGG + Intronic
1084026821 11:66455876-66455898 AGGGCAAGTGCAGCAGCCCCAGG + Intronic
1085528877 11:77180002-77180024 AGTGTCCATGCATCACCCTCAGG + Intronic
1087086072 11:94219957-94219979 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
1202827553 11_KI270721v1_random:95466-95488 AGAGCCCATGCACCTCCCTCTGG - Intergenic
1091998143 12:5011230-5011252 AGGGCCCCTGCAGCATCAACTGG - Intergenic
1094493356 12:30975132-30975154 AGGGCCCCTGCGGCACACGCTGG - Intronic
1094740375 12:33281750-33281772 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
1098161107 12:67648878-67648900 CGGGCGGCTGCAGCACCCTCCGG - Exonic
1100231273 12:92610531-92610553 AGGGCCCGTGCCCCACCCAAAGG - Intergenic
1100403025 12:94248792-94248814 AGGGCCTCTTCAGCACACTCTGG + Intronic
1101399107 12:104372931-104372953 ACTGCCCGTGCAGCACCCAGGGG - Intergenic
1105774621 13:23646124-23646146 TGGGCCAGTGCGGCACCCCCCGG + Intronic
1106289169 13:28344506-28344528 AGGCCCTGTGCAAGACCCTCTGG - Intronic
1106322895 13:28659023-28659045 CGGCCCCGCGCAGCTCCCTCCGG + Intergenic
1113403486 13:110017480-110017502 AGCGCACGTGCAGCACCAGCTGG - Intergenic
1118845216 14:69543054-69543076 AATGCCCGTGGAGCACCCTCAGG + Intergenic
1121613214 14:95295025-95295047 AGGGCTGGTGCAGCACCCAGTGG - Intronic
1121816591 14:96933535-96933557 AGGGGCCGTTCTGCACTCTCGGG + Intergenic
1122115707 14:99526308-99526330 AGGCCCCGTGCAGCTCCTGCAGG + Intronic
1122874951 14:104659674-104659696 AGGGGCTGTGGAGCACCCTGGGG - Intergenic
1123431834 15:20224455-20224477 CTGCCCCGTGCAGCACCTTCAGG + Intergenic
1124348681 15:28939771-28939793 AGGGGCCCTGCTGCACCCACAGG - Intronic
1125726350 15:41870192-41870214 CAGGCCCCTGCAGCCCCCTCAGG - Intronic
1127456596 15:59161053-59161075 AGGGCCCGTGGAGCACTTACGGG + Exonic
1127856994 15:62961242-62961264 CTGGCCCGTCCAGCACCCGCTGG - Intergenic
1128694074 15:69747353-69747375 AGGGCCCTTCCCACACCCTCAGG + Intergenic
1131263718 15:90903353-90903375 AGGGCCCGCGGAGCAGACTCCGG + Exonic
1131537800 15:93252176-93252198 AGGGCCCGTGCAGGACATTGAGG - Intergenic
1132216251 15:100063808-100063830 AGAGGCCGTGCAGCATCCCCCGG + Intronic
1132744751 16:1431956-1431978 AGAGCCCGTGCAGCCCCCGTGGG - Intergenic
1136852810 16:33626785-33626807 CTGCCCCGTGCAGCACCTTCAGG - Intergenic
1137331746 16:47504848-47504870 TGGGCCAGTGGTGCACCCTCAGG - Intronic
1139545606 16:67648254-67648276 AAGGCTGGTGCAGCAGCCTCGGG - Exonic
1140126856 16:72125001-72125023 AAGGCCCAGGAAGCACCCTCTGG - Intronic
1142129886 16:88427712-88427734 AGGCCCCGAGCAGCACCCCTGGG + Exonic
1142410345 16:89912809-89912831 AGGGCCAGGGCTGCACCCTCAGG - Intronic
1142428280 16:90012134-90012156 GAGGCCCCTGCCGCACCCTCAGG - Intronic
1142851994 17:2708796-2708818 AGGGGCCCGGCAGCACCCACAGG + Intronic
1143119485 17:4598062-4598084 AGGCCTCATGCAGCAGCCTCGGG + Intronic
1143897289 17:10145956-10145978 AGGGCCTGGGCCTCACCCTCTGG - Intronic
1147580360 17:41624351-41624373 GCGGCCTGGGCAGCACCCTCGGG - Exonic
1152039603 17:77894344-77894366 AAGACCCCTTCAGCACCCTCTGG - Intergenic
1152070648 17:78132193-78132215 CGGGCCCACGCAGCACCCCCAGG + Intronic
1152442833 17:80319494-80319516 AGGGACTGTGCAGCACACTGAGG - Intronic
1152947718 17:83207000-83207022 AGAGCCCGGGCAAGACCCTCTGG - Intergenic
1156993570 18:43439556-43439578 TGGTCTCCTGCAGCACCCTCAGG + Intergenic
1160015122 18:75134247-75134269 AGGCCCTGGGCAGCATCCTCTGG - Intergenic
1160276881 18:77445112-77445134 AGGGTCAGCGCAGTACCCTCAGG + Intergenic
1161442207 19:4298304-4298326 TGGGCCCCTGCTGCACGCTCAGG + Exonic
1161524018 19:4742503-4742525 AGGCCACGTGCAACAGCCTCGGG - Intergenic
1161582115 19:5086726-5086748 CGAGCCAGTGCAGCTCCCTCTGG + Intronic
1163786055 19:19275497-19275519 AGGGGCTGGGCAGCACCCACTGG + Intergenic
1165360835 19:35336001-35336023 AGAGCCCGTGCAGGAGCCTGGGG - Intronic
1166232345 19:41432257-41432279 AGGGCCGGAGGAGCAGCCTCGGG - Exonic
1166541264 19:43607646-43607668 AGTGCCCGTGCAGCTCCCCCAGG + Exonic
1166982314 19:46638727-46638749 AGGGCGCGCGCAGCACGCCCAGG + Intergenic
1166999567 19:46737969-46737991 AGGTCCCGTGCTGGACCCTGGGG - Intronic
1167125232 19:47544740-47544762 ACGGCCCCTGCAGCGGCCTCAGG + Exonic
1167502725 19:49856798-49856820 AGAGCCCGTGCAGCGCCCATCGG - Intronic
1168175443 19:54624778-54624800 AGGGCACAGGCAGAACCCTCAGG + Intronic
1168186802 19:54705342-54705364 AGAGACCCTGCAGCACACTCAGG + Intergenic
1168224111 19:54982289-54982311 AGGGCCCGGGAAGCACCCTGGGG - Exonic
927711646 2:25329845-25329867 AAGGCCCGCCCAGCATCCTCTGG - Intronic
932192502 2:69752674-69752696 AGGGACGATGCAGCCCCCTCTGG + Intronic
936573932 2:113637918-113637940 AGGGCCCGTGCAGCAGACTGGGG - Intronic
937025889 2:118696842-118696864 AGGGCCAGTGCAGAAGGCTCGGG + Intergenic
940982987 2:160024024-160024046 AGGACCCCTGCAGCCCCCACAGG + Intronic
946362758 2:219229130-219229152 AGGGCCCGTGGAGCCCCGGCCGG + Exonic
948585266 2:239015281-239015303 GGGGGCCTTGCAGCACCCCCAGG - Intergenic
948746215 2:240095878-240095900 ACGGCCGGTGCAGGAGCCTCGGG + Intergenic
948968048 2:241400117-241400139 AGGGCTCCTGGAGCACACTCTGG + Intronic
1174169377 20:48606703-48606725 AGAGCCCCTCCTGCACCCTCTGG + Intergenic
1175277739 20:57783438-57783460 ATGGCCCTTTCTGCACCCTCTGG - Intergenic
1175832845 20:61976524-61976546 AGGCCCCATGCTGCACCTTCAGG + Intronic
1175998986 20:62823799-62823821 GGGGGCCTTGCAGCAGCCTCAGG - Intronic
1179194450 21:39152299-39152321 AGGGCCAGTGCAGAACCTTTGGG - Intergenic
1179588994 21:42392903-42392925 GGGGCCCCTGCAGTGCCCTCAGG - Intronic
1180116006 21:45705455-45705477 AGGGCTCCTGCAGCTCCCTGGGG + Intronic
1180151059 21:45948129-45948151 AGGGCTTCTGCAGCAGCCTCAGG - Intergenic
1180948413 22:19709348-19709370 TGGTCCCGTGCAGCCCCCTCAGG + Intergenic
1181278799 22:21703797-21703819 AGGGCCCGTGCCGCTCCCCCCGG + Intronic
1182516907 22:30864296-30864318 TGGGCCCGTTCACCAGCCTCTGG - Intronic
1182688885 22:32142150-32142172 AGGGCCCCTGAAGCACCATGGGG + Intergenic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1184898170 22:47424498-47424520 CGAGCCCGTGCAGGACCCCCTGG + Intergenic
1185426244 22:50772975-50772997 AGGGCCCGTGCAGCAGACTGGGG + Intronic
954708158 3:52492046-52492068 GGGGCCCCTGCAGCACCCAGGGG - Exonic
956086264 3:65614240-65614262 AAGGCCCTTCCAGCACCTTCAGG - Intronic
956834687 3:73087063-73087085 AGGGCACGTGCAACAACATCTGG + Intergenic
957623081 3:82620894-82620916 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
959846106 3:111035716-111035738 AGGGACCCTGCAGCACCTTTGGG - Intergenic
963439281 3:145316518-145316540 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
965064536 3:163829557-163829579 AGGGAACTTGCAGCACCTTCTGG + Intergenic
967265303 3:187686188-187686210 TGGGCTCCTGCAGTACCCTCAGG + Intergenic
967266904 3:187699197-187699219 GGGACCCGAGCAGCATCCTCAGG + Intronic
967824416 3:193867192-193867214 AGTGCCCATGCATCACCCTGAGG - Intergenic
969993941 4:11292547-11292569 AAGGCCCGGGCAGCAGCCTGAGG - Intergenic
971405171 4:26315697-26315719 TGGTCCCCTGCAGTACCCTCAGG - Intronic
973870291 4:55159468-55159490 AGGGCCCATGCTGCACCAGCAGG + Intergenic
977720222 4:100231042-100231064 TGGTCCCCTGCAGTACCCTCAGG - Intergenic
984704066 4:182835097-182835119 AAGGCGCGTGCAGAACCCGCTGG - Intergenic
984808803 4:183776032-183776054 AGGGGCAGTGAAGCACCCTGGGG + Intergenic
985760482 5:1746310-1746332 AGGGCCCTGGCAGGACCCTGAGG + Intergenic
986301377 5:6481117-6481139 ATGGCCCGAGAAGCACGCTCCGG - Intronic
991049077 5:62253462-62253484 CTGCCCCGTGCAGCACCTTCAGG + Intergenic
998045725 5:138985087-138985109 AGGGCCCATGCCACACCCTTAGG - Intronic
999077250 5:148807845-148807867 AGGGTCTGTGCTGCATCCTCAGG + Intergenic
1006984790 6:38169234-38169256 AGGGCACTGGCCGCACCCTCAGG + Exonic
1013855244 6:114564541-114564563 TGGTCTCCTGCAGCACCCTCAGG + Intergenic
1014009740 6:116462048-116462070 AGTGCCCGTGCAGCGCCGCCTGG + Exonic
1015341860 6:132109918-132109940 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
1018214474 6:161513677-161513699 AAGGCCCGTACAGCATGCTCAGG - Intronic
1019104998 6:169660465-169660487 AGGGCCCTTCCCGGACCCTCGGG - Intronic
1019493058 7:1324000-1324022 AGGGCCCGTCCAGTGCCCTGGGG + Intergenic
1019861001 7:3658003-3658025 AAGGCCTGTGCAGGACCCTTTGG - Intronic
1022416178 7:30179046-30179068 AGAGTCCGTCCAGCACCCTAGGG + Intergenic
1032083455 7:128871241-128871263 AGGGGCTGTGCAGGTCCCTCTGG - Intronic
1033273953 7:139957075-139957097 AGGGCCCATGCTGCACCCAGGGG + Intronic
1034082512 7:148292717-148292739 AGGGTCCCTGCAGCATCCTTGGG - Intronic
1034251770 7:149697965-149697987 CGGTCTCCTGCAGCACCCTCAGG + Intergenic
1034818271 7:154193562-154193584 AGGGCCAGAGCAGCACCTGCAGG + Intronic
1036121290 8:6020456-6020478 AGGGCCTTTGCAGCCCCGTCTGG - Intergenic
1044070273 8:87751671-87751693 TGGTCTCCTGCAGCACCCTCGGG - Intergenic
1044335897 8:90984943-90984965 AGGGCCCCTTCAGTACCCTGTGG - Intronic
1045556980 8:103224258-103224280 ATGGCCCGTGACACACCCTCAGG + Intronic
1045813980 8:106258118-106258140 TGGTCTCCTGCAGCACCCTCAGG + Intergenic
1048297850 8:133227857-133227879 TGGGCCTGAGCAGCACCATCAGG - Exonic
1049381724 8:142319614-142319636 AAGGCCCCTGCAGGCCCCTCAGG + Intronic
1052125919 9:24774373-24774395 TGGTCTCCTGCAGCACCCTCAGG - Intergenic
1056822724 9:89854818-89854840 AGGGACCGTGCAGCAGTCTCTGG + Intergenic
1057279179 9:93698100-93698122 AGGGAGCGTGCAGCTTCCTCGGG + Intergenic
1057355077 9:94325662-94325684 GGGGCCTGTGAAGCCCCCTCAGG - Exonic
1057505842 9:95632795-95632817 TGGGCACCTGCAGCACCATCAGG - Intergenic
1057652674 9:96931972-96931994 GGGGCCTGTGAAGCCCCCTCAGG + Exonic
1061040238 9:128137466-128137488 AGGGACCATGCAGCAGTCTCTGG - Intergenic
1062444241 9:136587047-136587069 CGGCCCAGTGCTGCACCCTCAGG - Intergenic
1062729003 9:138097948-138097970 AGGGCCCGTGCAGCACCCTCTGG - Intronic
1185461520 X:334804-334826 AGGTCCCGTGCAGCTCGCTTTGG - Intronic
1187726252 X:22205305-22205327 AGGATCCCTGCAGCAGCCTCTGG - Intronic
1191115059 X:56843768-56843790 AGGACACCTGCAGCACCTTCAGG + Intergenic
1191192306 X:57679652-57679674 AGGGCCCGGGAAGCACCCTGGGG + Intergenic
1193712086 X:84893049-84893071 TGGTCTCCTGCAGCACCCTCAGG + Intergenic