ID: 1062733468

View in Genome Browser
Species Human (GRCh38)
Location 9:138121652-138121674
Sequence AGCCCACGGCTGAGCCGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062733468_1062733474 27 Left 1062733468 9:138121652-138121674 CCAGGCCGGCTCAGCCGTGGGCT 0: 1
1: 0
2: 2
3: 10
4: 168
Right 1062733474 9:138121702-138121724 AGACCCCCTCAGCCAGCCCCTGG 0: 1
1: 0
2: 2
3: 34
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062733468 Original CRISPR AGCCCACGGCTGAGCCGGCC TGG (reversed) Exonic
900403745 1:2483572-2483594 AGCCCAGGGCTGGGCAGGGCAGG - Intronic
900649067 1:3722255-3722277 AGCCCCCGGCTGTGCTGTCCGGG - Intronic
900661965 1:3789255-3789277 AGCCCAGGGCACAGCCTGCCTGG + Intronic
900972565 1:5999691-5999713 TGCCCACGGCAGAGGAGGCCAGG + Intronic
901044187 1:6385738-6385760 GGCTCACTGCTGAGCCGGCCAGG - Exonic
901216765 1:7559407-7559429 AGCCCCTGGCTGAGACAGCCTGG - Intronic
901493349 1:9607732-9607754 AGGGCCCGGCTGAGGCGGCCAGG - Exonic
901551115 1:9997085-9997107 AGCACCGGGCTGAGGCGGCCGGG + Intergenic
901879246 1:12184579-12184601 AGGCCACCACTCAGCCGGCCTGG + Intronic
904762895 1:32818005-32818027 AGCCTCCCGCCGAGCCGGCCGGG - Exonic
906480275 1:46194880-46194902 AGCCCAGGGCAGGGCCAGCCTGG + Exonic
908547719 1:65178389-65178411 GGCACACGGCTGAGTCTGCCTGG + Intronic
915196614 1:154194411-154194433 AGCCCACGATGGAGCCTGCCAGG - Intronic
922602969 1:226870863-226870885 AGGCGGCGGCTGGGCCGGCCCGG + Intronic
924441688 1:244091020-244091042 AGCCCAAGGGGGAGCCAGCCTGG + Intergenic
1066023084 10:31320858-31320880 AGCCCCCGCCTGCGCCGCCCCGG + Intronic
1066302364 10:34108256-34108278 GTCCCAAGGCGGAGCCGGCCCGG - Intergenic
1073104818 10:101026518-101026540 GGCCCACAGCTGAGCCTCCCTGG - Intronic
1074116409 10:110460306-110460328 CTCCCACGGCTGACCCAGCCAGG + Intergenic
1074857849 10:117486578-117486600 AGCTCACACCTGAGCCAGCCTGG + Intergenic
1074889231 10:117721294-117721316 AGCCCACTTCTGTGCCCGCCTGG - Intergenic
1077298428 11:1836617-1836639 AGCCCAAGGCAGAGCTGGCAGGG + Intronic
1083855087 11:65389326-65389348 AGGCCTCAGCTGAGCCTGCCTGG + Intronic
1083878840 11:65538445-65538467 AGGTCAAGGCTGAGCTGGCCCGG + Exonic
1083902938 11:65652505-65652527 AGCCGACGGCTGAGCTGCGCAGG - Intergenic
1085341942 11:75737493-75737515 AGCCCATGACTGAGCCAGCCAGG + Intergenic
1085350977 11:75797736-75797758 GGCCCAGGGCTGAGCCTGCAGGG - Intronic
1088259187 11:107928524-107928546 AGCCCGCGGGTGGGGCGGCCCGG + Exonic
1091219161 11:133920254-133920276 CGCCCCCGGCTCAGCCGGCTCGG + Exonic
1091237292 11:134030899-134030921 AACACACGCCTCAGCCGGCCTGG - Intergenic
1092849273 12:12612106-12612128 CTCCCCCGGCTCAGCCGGCCTGG - Exonic
1094646255 12:32327612-32327634 AGCTCAAGGCTGAGCTGGACGGG + Exonic
1097175710 12:57141694-57141716 AGCCCACGGCTGAGGCCCACAGG - Intronic
1098041293 12:66356086-66356108 AGCCCACAGATAGGCCGGCCTGG - Intronic
1101504140 12:105330876-105330898 AGCCCATCGCGCAGCCGGCCGGG - Exonic
1101875421 12:108593884-108593906 AGCCCTCTGCTGGGCCGGGCAGG - Intronic
1102248353 12:111369035-111369057 CTCCCGCGGCTGCGCCGGCCCGG - Exonic
1103583921 12:121936975-121936997 AGACCACGGCTGACCGGGCATGG - Intronic
1103940949 12:124500870-124500892 AGCCCGCGGCTGAGCGCTCCGGG - Intronic
1104666594 12:130651535-130651557 TGCCCACGGCACAGCCGTCCTGG + Intronic
1106462982 13:29989341-29989363 AGCACACCCCTGAGCCAGCCAGG - Intergenic
1107672684 13:42762198-42762220 AGCCCACTGCTGGGCCATCCAGG + Intergenic
1114065360 14:19054953-19054975 AGCCCACCGCTGAGGCTGCAGGG + Intergenic
1114096902 14:19345049-19345071 AGCCCACCGCTGAGGCTGCAGGG - Intergenic
1117357089 14:54934755-54934777 TGCCCACGCCTGAGCAGGACAGG + Intergenic
1117999678 14:61511335-61511357 GGCCCACTGCAGAGCCTGCCTGG + Intronic
1118348580 14:64957715-64957737 ATCCCACAGCTGAGCTGGACTGG + Intronic
1121339924 14:93099147-93099169 CCCCCACAGCTGAGCAGGCCTGG - Intronic
1121957306 14:98226287-98226309 AGCCCTGGGCTCAGCTGGCCTGG - Intergenic
1122408123 14:101512377-101512399 AGGCCGTGGCTGAGCAGGCCAGG + Intergenic
1123491258 15:20784190-20784212 AGCCCACCGCTGAGGCTGCAGGG - Intergenic
1123547760 15:21353281-21353303 AGCCCACCGCTGAGGCTGCAGGG - Intergenic
1123691119 15:22838869-22838891 TGCCCAAGGCTGCGCCGGCGAGG + Exonic
1125511182 15:40293243-40293265 AGCCCAAGGCTGAGGGGGCCTGG + Intronic
1128309709 15:66622415-66622437 AGCCCGCGGCCGACCCCGCCTGG + Intronic
1128456771 15:67835579-67835601 AGCCCTGGGCTGAGGGGGCCGGG + Intergenic
1131493541 15:92882999-92883021 AGCCCGCGGCAGAGGCGCCCAGG + Intergenic
1131517522 15:93089056-93089078 GGGCCGCTGCTGAGCCGGCCGGG - Intronic
1131517540 15:93089115-93089137 AGCGCCTGGCGGAGCCGGCCCGG + Intronic
1202956090 15_KI270727v1_random:80511-80533 AGCCCACCGCTGAGGCTGCAGGG - Intergenic
1132605310 16:791243-791265 GGCCCAGTGTTGAGCCGGCCCGG + Exonic
1132626838 16:895266-895288 AGCCCGAGGCTGACCCGACCAGG - Intronic
1132708329 16:1255881-1255903 AGCCCTCGGCGGGGCCTGCCTGG + Intergenic
1136187994 16:28599405-28599427 AGGACACGGCTGCCCCGGCCTGG + Intergenic
1136190466 16:28612399-28612421 AGGACACGGCTGCCCCGGCCTGG + Intronic
1138373150 16:56543258-56543280 AGCCTAAGCCTGAGCAGGCCAGG - Intergenic
1141896077 16:86959469-86959491 AAGCCAAGGCTGAGCCCGCCAGG - Intergenic
1142178831 16:88657448-88657470 AGCCCGCCGCTGAGGAGGCCAGG + Exonic
1143564863 17:7715318-7715340 AGCCCAGGGCACAGCCGGCAGGG + Intergenic
1149989221 17:61371805-61371827 AGACCTCGGCTGAGCAGGGCTGG - Intronic
1150132383 17:62676105-62676127 AGCCCACACCTGTGCCTGCCCGG - Intronic
1159578461 18:70207473-70207495 AGCCCATGCCTAAGCCTGCCTGG + Intergenic
1160357116 18:78237890-78237912 AGCCCAGGGATGGGTCGGCCAGG - Intergenic
1160723470 19:607540-607562 AGTCCTCAGCTGACCCGGCCGGG - Intronic
1161281624 19:3448796-3448818 ATCCCCCGGCTGTGCCGCCCTGG + Intronic
1161703036 19:5805260-5805282 AGCCCGCGGCTAAGCGAGCCCGG + Intergenic
1161864669 19:6825247-6825269 AGCCCAGGGCTCAGGGGGCCAGG - Intronic
1163234983 19:16024827-16024849 ACCCCAGGGCTGTGCCGGCTGGG - Intergenic
1164526495 19:29017091-29017113 AGCCCATGTCTGAGCCAGGCAGG - Intergenic
1165805889 19:38580330-38580352 AGCCCAGGGCGGAGCTGACCTGG + Intronic
1166366098 19:42279291-42279313 GGCCCAGGGCTGAGCAGTCCTGG + Intronic
1168308908 19:55451230-55451252 AGGCCAGGGCTGGGCCGGGCGGG + Intergenic
925128215 2:1476831-1476853 AGACCACCGGTGAGCAGGCCAGG + Intronic
925578416 2:5384676-5384698 AGCCCAAGGCTTAGCTTGCCTGG + Intergenic
928198298 2:29230478-29230500 ACCCTACGGGTGAACCGGCCTGG + Intronic
929454077 2:42054239-42054261 AGCCCTGGGCTGAGCAGGGCAGG - Exonic
929593552 2:43162020-43162042 AGCCCCAGGGTGAGCTGGCCGGG + Intergenic
929919602 2:46162915-46162937 AGCCCACGGATGACTCGGGCTGG - Intronic
934649577 2:96083335-96083357 AGCCCAAGGCAGAGCCTGCTCGG + Intergenic
934713867 2:96532034-96532056 AGCCCAGGGCTCAGCTGGCAGGG + Intergenic
935237462 2:101150987-101151009 AGCCCGCGGCAGGGCCGTCCGGG + Intronic
936513559 2:113167671-113167693 AGCCCACAGCTGAGCTGGCCAGG + Intronic
937984046 2:127630652-127630674 GGCCCAGGGCTGAACAGGCCAGG - Intronic
938482624 2:131673955-131673977 AGCCCACCGCTGAGGCCGCAGGG + Intergenic
940316723 2:152335192-152335214 CGGCCACGGCTGCGCCTGCCTGG - Intergenic
942459687 2:176160404-176160426 AGGCCAAGACTGAGTCGGCCCGG + Intronic
947856618 2:233328537-233328559 AGCCCCGAGCTGAGGCGGCCTGG + Exonic
948192534 2:236071078-236071100 AGCCCACGGCTTTGCCGGCATGG + Intronic
948563480 2:238868802-238868824 AGCCCACGGCTCAGCAAGGCTGG + Intronic
1171034701 20:21705836-21705858 AGCCCGCGGCTGGGCCGCCGCGG + Exonic
1172614861 20:36276268-36276290 AGCCAAGGGATGAGCCAGCCTGG + Intergenic
1173247161 20:41344799-41344821 AGACCAGGGCTGAGCTGGCTAGG - Intronic
1175342962 20:58246495-58246517 ACTCCAGGGCTGAGCCGGCCTGG + Intergenic
1176112141 20:63415592-63415614 TGGCCACGCCTGAGCCAGCCGGG - Intronic
1176447362 21:6831626-6831648 AGCCCACCGCTGAGGCTGCAGGG + Intergenic
1176825530 21:13696652-13696674 AGCCCACCGCTGAGGCTGCAGGG + Intergenic
1179189914 21:39115114-39115136 ACCACATGGCTGAGCTGGCCTGG - Intergenic
1180791236 22:18576847-18576869 AGCCCAGTGCTGAGCCGGATGGG - Intergenic
1181230502 22:21418467-21418489 AGCCCAGTGCTGAGCCGGATGGG + Intronic
1181248148 22:21516402-21516424 AGCCCAGTGCTGAGCCGGATGGG - Intergenic
1181306424 22:21919832-21919854 GGAACACGGCTGAGACGGCCCGG + Exonic
1184654018 22:45932185-45932207 AGCCCACGGCTGAGCTGGGAGGG + Intronic
1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG + Intergenic
1185076970 22:48688594-48688616 AACCCAGGGAGGAGCCGGCCAGG - Intronic
950091775 3:10300823-10300845 AGGCCACGGCTGTGATGGCCTGG - Intronic
950531979 3:13557543-13557565 ACCACACGGCAGAGCCTGCCTGG - Intronic
953705130 3:45225470-45225492 ACCCCGCGGCCGAGCCGCCCGGG - Exonic
953743804 3:45557844-45557866 AGCCTACAGCTGAGGGGGCCTGG + Intronic
954127122 3:48538033-48538055 AGCCCACGGCTGAGTTCGACTGG - Intronic
964891393 3:161540325-161540347 AGCCCAGGGCTGCCCCTGCCTGG - Intergenic
967055289 3:185824977-185824999 AGCCCGCGGCTCCCCCGGCCCGG + Exonic
969633377 4:8351338-8351360 AGCCGAGAGCAGAGCCGGCCTGG + Intergenic
971140917 4:23924027-23924049 AGGCCAGGGCTGAGCCAGCATGG - Intergenic
972330371 4:38058448-38058470 TGCCCATGGCTCAGCCGCCCAGG - Intronic
973737385 4:53885855-53885877 GGCCCAGGGCTAAGCCAGCCTGG - Intronic
974108796 4:57501963-57501985 AGCCACCGGCAGAGCCGGCGTGG - Intergenic
975166713 4:71186586-71186608 AGCCCCCGGCGGAGGCGGCGCGG + Intergenic
978776930 4:112514728-112514750 AGTCCATGTCTGACCCGGCCGGG + Exonic
985618473 5:938640-938662 AGACCACGGCAGAGGCGACCTGG - Intergenic
990895861 5:60699843-60699865 GGCCCAGAGCTCAGCCGGCCGGG - Intronic
991054452 5:62306354-62306376 TGCCCGCGGCCGCGCCGGCCCGG - Intronic
992088635 5:73299185-73299207 GGCGCACGGCTGTGCCGCCCGGG - Intergenic
999172342 5:149606222-149606244 AGCCAACTGCAGAGACGGCCTGG - Intronic
999244648 5:150147420-150147442 AGCCCATGGCTGCTCCGGGCTGG - Intronic
1001307318 5:170584888-170584910 AGCCCAGAGCAGAGCAGGCCTGG + Intronic
1001591550 5:172868991-172869013 ATCCCACAGCTAAGCCAGCCCGG - Intronic
1002183735 5:177444331-177444353 AGCCCAAGGGGGAGCTGGCCAGG - Intergenic
1002321801 5:178380878-178380900 AGGCCAAGGCTGAGCAGGGCAGG + Intronic
1002405588 5:179027679-179027701 AGCCCACCTGTGAGCCGACCTGG - Intronic
1002715127 5:181222505-181222527 CACACACGGCTGAGACGGCCGGG + Intronic
1006794372 6:36722374-36722396 AGCCCCAGGCTGAGCCCCCCTGG - Exonic
1013342601 6:109229850-109229872 AGCCCAGGGCTGAGGCTGCTGGG + Intergenic
1014057256 6:117030562-117030584 ACCCCAGGGCTGGGCTGGCCTGG - Intergenic
1016813389 6:148282171-148282193 AGCCAGTGGCTGAGCCGGGCAGG + Intronic
1019289856 7:245152-245174 AGCCCTCGGCTTCCCCGGCCGGG - Intronic
1019715393 7:2536493-2536515 AGCCCACGGCTGTGCCACCCGGG + Intergenic
1019741425 7:2676647-2676669 AGCCCACGGCTGTGCCACCCAGG - Intergenic
1020224823 7:6272216-6272238 AGCCCGCGGCAGCCCCGGCCTGG + Intronic
1022100484 7:27166377-27166399 ACCCCACGGAGGAGCTGGCCAGG + Intronic
1022980610 7:35601760-35601782 AGCCCACAGCTGGGCCAGGCTGG + Intergenic
1023931184 7:44707628-44707650 ACCCCAATGCTGAGCTGGCCTGG + Exonic
1025738958 7:64181639-64181661 AACCCACCGCGGGGCCGGCCCGG - Intronic
1029252245 7:99245104-99245126 ACCCCACGGCTGAGACAGGCTGG + Intergenic
1034223975 7:149468674-149468696 AGCCCATGGCTGAGCAGGTGGGG + Intergenic
1034254032 7:149714805-149714827 AGCCCCCGGCTTCGGCGGCCCGG - Intronic
1034501214 7:151452177-151452199 AGCCCACAGCTCAGGCGGCCCGG + Intergenic
1035267734 7:157700859-157700881 AGCCCACCGCTGAGCCAGCCAGG - Intronic
1035682062 8:1495432-1495454 AGCCGGAGACTGAGCCGGCCAGG + Intergenic
1038799225 8:30734103-30734125 AGCACACGGCTGAGCCCGGTAGG + Intronic
1041244892 8:55880294-55880316 AGCCGACGGGTGACCGGGCCCGG + Intronic
1049323833 8:142011498-142011520 TGCTCACGGCAGAGCCAGCCTGG - Intergenic
1049342133 8:142118838-142118860 AGCTCCCTGCAGAGCCGGCCAGG - Intergenic
1049394430 8:142392997-142393019 AGATGACGGCTGGGCCGGCCAGG + Intronic
1049546358 8:143233274-143233296 AGCTCAAGGCTGAGTCGGCTTGG + Intergenic
1049593350 8:143472495-143472517 TCCCCACTGCTGAGCGGGCCAGG + Intronic
1049800813 8:144516746-144516768 GGCCCAGGGCTGGTCCGGCCTGG + Exonic
1056578084 9:87870898-87870920 GGCCCACGGCTGAGTGGGGCTGG + Intergenic
1056870434 9:90272552-90272574 AGCTCACCACCGAGCCGGCCAGG + Intergenic
1057758244 9:97853666-97853688 AGCCGACGGCTCAGCCCGCGTGG - Exonic
1060205285 9:121679039-121679061 GGCCCAGCGCTGAGCTGGCCCGG + Intronic
1061862067 9:133473236-133473258 AGCCCACGGCGTAGCCTGCTCGG + Exonic
1062218784 9:135403376-135403398 GGCCTGGGGCTGAGCCGGCCTGG - Intergenic
1062503022 9:136859309-136859331 AGCCCAGGGCTCACCCGGGCTGG - Exonic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062558646 9:137129338-137129360 CGACCACGGCTGCCCCGGCCCGG + Intergenic
1062733468 9:138121652-138121674 AGCCCACGGCTGAGCCGGCCTGG - Exonic
1203521828 Un_GL000213v1:52905-52927 AGCCCACCGCTGAGGCTGCAGGG - Intergenic
1189308823 X:40006211-40006233 CGCCTAGCGCTGAGCCGGCCAGG + Intergenic
1189666991 X:43366302-43366324 AGTCCAGGGTTGAGCAGGCCAGG - Intergenic
1195694676 X:107658111-107658133 TGCCCACTGCTAAGCAGGCCAGG - Intergenic
1197819291 X:130529444-130529466 TGCCCAGGGCTGAGACGGCAGGG - Intergenic