ID: 1062736005

View in Genome Browser
Species Human (GRCh38)
Location 9:138137733-138137755
Sequence CTTCATCAGGTGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062735993_1062736005 -7 Left 1062735993 9:138137717-138137739 CCAGCCCCGGGCTCCCCTTCATC No data
Right 1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG No data
1062735988_1062736005 14 Left 1062735988 9:138137696-138137718 CCCCAGAGCTGGGTCAGGGCTCC No data
Right 1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG No data
1062735983_1062736005 25 Left 1062735983 9:138137685-138137707 CCACTGGTCTGCCCCAGAGCTGG No data
Right 1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG No data
1062735990_1062736005 12 Left 1062735990 9:138137698-138137720 CCAGAGCTGGGTCAGGGCTCCAG No data
Right 1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG No data
1062735989_1062736005 13 Left 1062735989 9:138137697-138137719 CCCAGAGCTGGGTCAGGGCTCCA No data
Right 1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062736005 Original CRISPR CTTCATCAGGTGAGGGTGGA GGG Intergenic
No off target data available for this crispr