ID: 1062737441

View in Genome Browser
Species Human (GRCh38)
Location 9:138145147-138145169
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062737438_1062737441 2 Left 1062737438 9:138145122-138145144 CCTGACTACATGTTCTTAGGCTC No data
Right 1062737441 9:138145147-138145169 ATGAAACAGAAGTTGATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062737441 Original CRISPR ATGAAACAGAAGTTGATACA AGG Intergenic
No off target data available for this crispr