ID: 1062741304

View in Genome Browser
Species Human (GRCh38)
Location 9:138176777-138176799
Sequence GGTGAGCTCAGCCACAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062741304_1062741307 7 Left 1062741304 9:138176777-138176799 CCTTGACTGTGGCTGAGCTCACC No data
Right 1062741307 9:138176807-138176829 TGTTTGATGCTAAGAACATGAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1062741304_1062741309 30 Left 1062741304 9:138176777-138176799 CCTTGACTGTGGCTGAGCTCACC No data
Right 1062741309 9:138176830-138176852 GCTGCCCGTGACCCCCGTCACGG No data
1062741304_1062741308 8 Left 1062741304 9:138176777-138176799 CCTTGACTGTGGCTGAGCTCACC No data
Right 1062741308 9:138176808-138176830 GTTTGATGCTAAGAACATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062741304 Original CRISPR GGTGAGCTCAGCCACAGTCA AGG (reversed) Intergenic
No off target data available for this crispr