ID: 1062744502

View in Genome Browser
Species Human (GRCh38)
Location 9:138202732-138202754
Sequence CGGCCTCAGTGACTGGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062744502_1062744510 12 Left 1062744502 9:138202732-138202754 CCAATGGCCAGTCACTGAGGCCG No data
Right 1062744510 9:138202767-138202789 GTCTCCAAGAAGCCCCAACATGG No data
1062744502_1062744512 16 Left 1062744502 9:138202732-138202754 CCAATGGCCAGTCACTGAGGCCG No data
Right 1062744512 9:138202771-138202793 CCAAGAAGCCCCAACATGGAAGG No data
1062744502_1062744513 22 Left 1062744502 9:138202732-138202754 CCAATGGCCAGTCACTGAGGCCG No data
Right 1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062744502 Original CRISPR CGGCCTCAGTGACTGGCCAT TGG (reversed) Intergenic
No off target data available for this crispr