ID: 1062744507

View in Genome Browser
Species Human (GRCh38)
Location 9:138202762-138202784
Sequence TTGGGGCTTCTTGGAGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062744507_1062744513 -8 Left 1062744507 9:138202762-138202784 CCCCTGTCTCCAAGAAGCCCCAA No data
Right 1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062744507 Original CRISPR TTGGGGCTTCTTGGAGACAG GGG (reversed) Intergenic
No off target data available for this crispr