ID: 1062744513

View in Genome Browser
Species Human (GRCh38)
Location 9:138202777-138202799
Sequence AGCCCCAACATGGAAGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062744508_1062744513 -9 Left 1062744508 9:138202763-138202785 CCCTGTCTCCAAGAAGCCCCAAC No data
Right 1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG No data
1062744507_1062744513 -8 Left 1062744507 9:138202762-138202784 CCCCTGTCTCCAAGAAGCCCCAA No data
Right 1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG No data
1062744502_1062744513 22 Left 1062744502 9:138202732-138202754 CCAATGGCCAGTCACTGAGGCCG No data
Right 1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG No data
1062744504_1062744513 15 Left 1062744504 9:138202739-138202761 CCAGTCACTGAGGCCGTGGTCCT No data
Right 1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG No data
1062744505_1062744513 2 Left 1062744505 9:138202752-138202774 CCGTGGTCCTCCCCTGTCTCCAA No data
Right 1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG No data
1062744509_1062744513 -10 Left 1062744509 9:138202764-138202786 CCTGTCTCCAAGAAGCCCCAACA No data
Right 1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG No data
1062744506_1062744513 -5 Left 1062744506 9:138202759-138202781 CCTCCCCTGTCTCCAAGAAGCCC No data
Right 1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062744513 Original CRISPR AGCCCCAACATGGAAGGCTC AGG Intergenic
No off target data available for this crispr