ID: 1062745198

View in Genome Browser
Species Human (GRCh38)
Location 9:138207513-138207535
Sequence GCCTCAAGAGATCAGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062745198_1062745207 23 Left 1062745198 9:138207513-138207535 CCTGGGTGCTGATCTCTTGAGGC No data
Right 1062745207 9:138207559-138207581 TTGGCCACCCACACCTCCCCTGG No data
1062745198_1062745202 -1 Left 1062745198 9:138207513-138207535 CCTGGGTGCTGATCTCTTGAGGC No data
Right 1062745202 9:138207535-138207557 CCACGTGAGGGCTCCATCCCTGG No data
1062745198_1062745210 28 Left 1062745198 9:138207513-138207535 CCTGGGTGCTGATCTCTTGAGGC No data
Right 1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG No data
1062745198_1062745203 4 Left 1062745198 9:138207513-138207535 CCTGGGTGCTGATCTCTTGAGGC No data
Right 1062745203 9:138207540-138207562 TGAGGGCTCCATCCCTGGCTTGG No data
1062745198_1062745208 24 Left 1062745198 9:138207513-138207535 CCTGGGTGCTGATCTCTTGAGGC No data
Right 1062745208 9:138207560-138207582 TGGCCACCCACACCTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062745198 Original CRISPR GCCTCAAGAGATCAGCACCC AGG (reversed) Intergenic
No off target data available for this crispr