ID: 1062745201

View in Genome Browser
Species Human (GRCh38)
Location 9:138207535-138207557
Sequence CCAGGGATGGAGCCCTCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062745201_1062745217 21 Left 1062745201 9:138207535-138207557 CCACGTGAGGGCTCCATCCCTGG No data
Right 1062745217 9:138207579-138207601 TGGGCCGGCACCTTCTTATCTGG No data
1062745201_1062745208 2 Left 1062745201 9:138207535-138207557 CCACGTGAGGGCTCCATCCCTGG No data
Right 1062745208 9:138207560-138207582 TGGCCACCCACACCTCCCCTGGG No data
1062745201_1062745210 6 Left 1062745201 9:138207535-138207557 CCACGTGAGGGCTCCATCCCTGG No data
Right 1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG No data
1062745201_1062745207 1 Left 1062745201 9:138207535-138207557 CCACGTGAGGGCTCCATCCCTGG No data
Right 1062745207 9:138207559-138207581 TTGGCCACCCACACCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062745201 Original CRISPR CCAGGGATGGAGCCCTCACG TGG (reversed) Intergenic
No off target data available for this crispr