ID: 1062745210

View in Genome Browser
Species Human (GRCh38)
Location 9:138207564-138207586
Sequence CACCCACACCTCCCCTGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062745198_1062745210 28 Left 1062745198 9:138207513-138207535 CCTGGGTGCTGATCTCTTGAGGC No data
Right 1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG No data
1062745201_1062745210 6 Left 1062745201 9:138207535-138207557 CCACGTGAGGGCTCCATCCCTGG No data
Right 1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG No data
1062745204_1062745210 -7 Left 1062745204 9:138207548-138207570 CCATCCCTGGCTTGGCCACCCAC No data
Right 1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062745210 Original CRISPR CACCCACACCTCCCCTGGGC CGG Intergenic
No off target data available for this crispr