ID: 1062745217

View in Genome Browser
Species Human (GRCh38)
Location 9:138207579-138207601
Sequence TGGGCCGGCACCTTCTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062745206_1062745217 3 Left 1062745206 9:138207553-138207575 CCTGGCTTGGCCACCCACACCTC No data
Right 1062745217 9:138207579-138207601 TGGGCCGGCACCTTCTTATCTGG No data
1062745209_1062745217 -7 Left 1062745209 9:138207563-138207585 CCACCCACACCTCCCCTGGGCCG No data
Right 1062745217 9:138207579-138207601 TGGGCCGGCACCTTCTTATCTGG No data
1062745205_1062745217 4 Left 1062745205 9:138207552-138207574 CCCTGGCTTGGCCACCCACACCT No data
Right 1062745217 9:138207579-138207601 TGGGCCGGCACCTTCTTATCTGG No data
1062745201_1062745217 21 Left 1062745201 9:138207535-138207557 CCACGTGAGGGCTCCATCCCTGG No data
Right 1062745217 9:138207579-138207601 TGGGCCGGCACCTTCTTATCTGG No data
1062745204_1062745217 8 Left 1062745204 9:138207548-138207570 CCATCCCTGGCTTGGCCACCCAC No data
Right 1062745217 9:138207579-138207601 TGGGCCGGCACCTTCTTATCTGG No data
1062745211_1062745217 -10 Left 1062745211 9:138207566-138207588 CCCACACCTCCCCTGGGCCGGCA No data
Right 1062745217 9:138207579-138207601 TGGGCCGGCACCTTCTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062745217 Original CRISPR TGGGCCGGCACCTTCTTATC TGG Intergenic
No off target data available for this crispr