ID: 1062746178

View in Genome Browser
Species Human (GRCh38)
Location 9:138213398-138213420
Sequence TTTCAAATGTGAATATACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062746172_1062746178 23 Left 1062746172 9:138213352-138213374 CCATTGAGCCGGGAAAGGCCTGC No data
Right 1062746178 9:138213398-138213420 TTTCAAATGTGAATATACCCAGG No data
1062746173_1062746178 15 Left 1062746173 9:138213360-138213382 CCGGGAAAGGCCTGCAGTAGCCA 0: 5
1: 0
2: 1
3: 23
4: 247
Right 1062746178 9:138213398-138213420 TTTCAAATGTGAATATACCCAGG No data
1062746174_1062746178 5 Left 1062746174 9:138213370-138213392 CCTGCAGTAGCCAATGCCCACAT No data
Right 1062746178 9:138213398-138213420 TTTCAAATGTGAATATACCCAGG No data
1062746175_1062746178 -5 Left 1062746175 9:138213380-138213402 CCAATGCCCACATTTGAGTTTCA No data
Right 1062746178 9:138213398-138213420 TTTCAAATGTGAATATACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062746178 Original CRISPR TTTCAAATGTGAATATACCC AGG Intergenic
No off target data available for this crispr