ID: 1062748203

View in Genome Browser
Species Human (GRCh38)
Location 9:138230373-138230395
Sequence TATAGATAGCAGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062748203_1062748207 -7 Left 1062748203 9:138230373-138230395 CCACACCTGGCCTGCTATCTATA No data
Right 1062748207 9:138230389-138230411 ATCTATATATTTTCTTTGGCTGG No data
1062748203_1062748208 27 Left 1062748203 9:138230373-138230395 CCACACCTGGCCTGCTATCTATA No data
Right 1062748208 9:138230423-138230445 GATATTTACCCAGTTTTATTTGG No data
1062748203_1062748209 28 Left 1062748203 9:138230373-138230395 CCACACCTGGCCTGCTATCTATA No data
Right 1062748209 9:138230424-138230446 ATATTTACCCAGTTTTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062748203 Original CRISPR TATAGATAGCAGGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr