ID: 1062761762

View in Genome Browser
Species Human (GRCh38)
Location 10:28005-28027
Sequence TCCAGCTGGCCAGCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062761752_1062761762 18 Left 1062761752 10:27964-27986 CCCACTCCCACAGCACCTCACAA No data
Right 1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG No data
1062761751_1062761762 19 Left 1062761751 10:27963-27985 CCCCACTCCCACAGCACCTCACA No data
Right 1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG No data
1062761755_1062761762 11 Left 1062761755 10:27971-27993 CCACAGCACCTCACAAGTCCCAT No data
Right 1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG No data
1062761760_1062761762 -8 Left 1062761760 10:27990-28012 CCATTGGCTTGGAATTCCAGCTG No data
Right 1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG No data
1062761759_1062761762 -7 Left 1062761759 10:27989-28011 CCCATTGGCTTGGAATTCCAGCT No data
Right 1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG No data
1062761757_1062761762 3 Left 1062761757 10:27979-28001 CCTCACAAGTCCCATTGGCTTGG No data
Right 1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG No data
1062761753_1062761762 17 Left 1062761753 10:27965-27987 CCACTCCCACAGCACCTCACAAG No data
Right 1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG No data
1062761754_1062761762 12 Left 1062761754 10:27970-27992 CCCACAGCACCTCACAAGTCCCA No data
Right 1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062761762 Original CRISPR TCCAGCTGGCCAGCAGCAGC AGG Intergenic
No off target data available for this crispr