ID: 1062773943

View in Genome Browser
Species Human (GRCh38)
Location 10:129718-129740
Sequence CTTGGATTCACAATATACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062773943_1062773947 15 Left 1062773943 10:129718-129740 CCTCTGTATATTGTGAATCCAAG No data
Right 1062773947 10:129756-129778 GAGTCCTGGCTTCCATCCCAGGG No data
1062773943_1062773945 1 Left 1062773943 10:129718-129740 CCTCTGTATATTGTGAATCCAAG No data
Right 1062773945 10:129742-129764 ATAAGTCTCTTAAAGAGTCCTGG No data
1062773943_1062773946 14 Left 1062773943 10:129718-129740 CCTCTGTATATTGTGAATCCAAG No data
Right 1062773946 10:129755-129777 AGAGTCCTGGCTTCCATCCCAGG No data
1062773943_1062773948 16 Left 1062773943 10:129718-129740 CCTCTGTATATTGTGAATCCAAG No data
Right 1062773948 10:129757-129779 AGTCCTGGCTTCCATCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062773943 Original CRISPR CTTGGATTCACAATATACAG AGG (reversed) Intergenic
No off target data available for this crispr