ID: 1062773945

View in Genome Browser
Species Human (GRCh38)
Location 10:129742-129764
Sequence ATAAGTCTCTTAAAGAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062773940_1062773945 8 Left 1062773940 10:129711-129733 CCCCATGCCTCTGTATATTGTGA No data
Right 1062773945 10:129742-129764 ATAAGTCTCTTAAAGAGTCCTGG No data
1062773941_1062773945 7 Left 1062773941 10:129712-129734 CCCATGCCTCTGTATATTGTGAA No data
Right 1062773945 10:129742-129764 ATAAGTCTCTTAAAGAGTCCTGG No data
1062773942_1062773945 6 Left 1062773942 10:129713-129735 CCATGCCTCTGTATATTGTGAAT No data
Right 1062773945 10:129742-129764 ATAAGTCTCTTAAAGAGTCCTGG No data
1062773943_1062773945 1 Left 1062773943 10:129718-129740 CCTCTGTATATTGTGAATCCAAG No data
Right 1062773945 10:129742-129764 ATAAGTCTCTTAAAGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062773945 Original CRISPR ATAAGTCTCTTAAAGAGTCC TGG Intergenic
No off target data available for this crispr