ID: 1062775355

View in Genome Browser
Species Human (GRCh38)
Location 10:140760-140782
Sequence GCTTAAGTATGTGCACGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062775355_1062775358 27 Left 1062775355 10:140760-140782 CCCTTACGTGCACATACTTAAGC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1062775358 10:140810-140832 TTACAGTTGCATTGAGTATGTGG No data
1062775355_1062775357 -7 Left 1062775355 10:140760-140782 CCCTTACGTGCACATACTTAAGC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1062775357 10:140776-140798 CTTAAGCTATTCACACTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062775355 Original CRISPR GCTTAAGTATGTGCACGTAA GGG (reversed) Intronic
907960355 1:59274102-59274124 GCTAAGCTATGGGCACGTAAAGG + Intergenic
908616289 1:65926452-65926474 TCTTAAGTTTGTGCTCCTAAGGG + Intronic
912185659 1:107272846-107272868 GCTTAAGCATTTGTACTTAATGG - Intronic
915204228 1:154257525-154257547 GCTTGAGTATGTGCAAGTTTTGG - Intronic
921773758 1:219073142-219073164 GCTAAAGTATGTGTATGCAAAGG - Intergenic
924447232 1:244144639-244144661 GTATAAGTATTAGCACGTAAAGG - Intergenic
924511688 1:244733107-244733129 GCTCAAGTATGTGCACTAAGAGG + Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1065259142 10:23906751-23906773 TCATAGGTATGTGCACATAATGG + Intronic
1066461030 10:35612333-35612355 GTTTAAGTGTGTGCACGTTGGGG + Intergenic
1079171882 11:18104601-18104623 GCTTAAATATCAGCACCTAAGGG - Intronic
1085963936 11:81498085-81498107 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1086390162 11:86355617-86355639 GCTCAAGTATGTGCACTGAGAGG + Intergenic
1089891089 11:121881708-121881730 GCTTAAGTATTTTCAAGAAAGGG + Intergenic
1096599751 12:52721200-52721222 CCTTAAGTTTGGGCAAGTAAAGG - Intergenic
1103093673 12:118116079-118116101 GCTTAAGCATGTGCATGAAGAGG - Intronic
1109351215 13:61184121-61184143 TTTTAAGTATGTGTACCTAAAGG - Intergenic
1110508101 13:76313713-76313735 GCTTAAGTATGTGTAGTTTAGGG - Intergenic
1117099762 14:52334267-52334289 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1127430594 15:58903524-58903546 GCTTAAGAATGTGCATCTGACGG + Intronic
1128596649 15:68957829-68957851 GCTCAAGTATGTGCACTAAGAGG + Intronic
1130401741 15:83562261-83562283 GCTCCAGTATGTGCATGTCAGGG + Intronic
1133911401 16:10069639-10069661 GCTCAAGTGTGTGCATCTAATGG - Intronic
1137746237 16:50822278-50822300 GCTTAAGCATGAGCACTTAGAGG - Intergenic
1140645542 16:77025870-77025892 GCTGAAGTATTTGAAAGTAATGG - Intergenic
1145091498 17:19989870-19989892 GCTAAAGTATGTGCTCGACAAGG - Intergenic
1146823376 17:36002299-36002321 GCTCAAGTATGTGCACTAAGAGG - Intergenic
1153994833 18:10431864-10431886 GATTAACTATGAGCACGTCAAGG + Intergenic
1159864841 18:73691640-73691662 GCTTAAGCATGTGCACTAAGAGG + Intergenic
927704916 2:25291021-25291043 TCTCAAGTCTGTGCACGTGACGG - Intronic
936157304 2:110056704-110056726 GTTTATGTATGTGCACATCAAGG + Intergenic
936187390 2:110314740-110314762 GTTTATGTATGTGCACATCAAGG - Intergenic
939755612 2:146105525-146105547 GCTCAAGTATGTGCACTAAGAGG - Intergenic
943977415 2:194502117-194502139 GCTTGAGAATATGCATGTAAAGG + Intergenic
1175587015 20:60149134-60149156 GCCCAAGTATGTGCACTAAATGG + Intergenic
1177020418 21:15849001-15849023 GCTTAAGTATTTGTACTTAATGG + Intronic
950020561 3:9784548-9784570 ATTTAAATATGTGCACATAAGGG - Intronic
954585094 3:51727349-51727371 TCTTAATTATGTGAACATAATGG - Intergenic
954891910 3:53938453-53938475 GCTTAAGGATGTGCAGGATAGGG - Intergenic
957222554 3:77402567-77402589 GCTCAACTATGTGCACTAAAAGG + Intronic
965279461 3:166729773-166729795 GCTTACTTATGTGCAAGTAATGG - Intergenic
967507005 3:190263819-190263841 GCTAAACTATGAGGACGTAAAGG + Intergenic
974170806 4:58264793-58264815 GCTCAAGTATGTGCACTAAGAGG + Intergenic
983847856 4:172541842-172541864 GCTCAAGCATGTGCACTAAAAGG - Intronic
989543462 5:42645133-42645155 GCTGAAGTATGTGGTCATAAAGG + Intronic
991145515 5:63298169-63298191 ACTAAAGTATGTGCACTGAAAGG - Intergenic
994281395 5:97907782-97907804 GCTTAAGCATGTGCACTAAGAGG + Intergenic
995347682 5:111139410-111139432 GTTCTAGTTTGTGCACGTAAAGG - Intergenic
999589291 5:153126263-153126285 ACTTAAGTATTTGCCTGTAAAGG + Intergenic
1002451981 5:179324227-179324249 GCTTTAGTATGTTCACAGAATGG - Intronic
1003204297 6:3993013-3993035 GCTCAAGCATGTGCACTCAAAGG - Intergenic
1012943495 6:105441869-105441891 CCTTTATTATGTGCACTTAAGGG - Intergenic
1031293464 7:119969819-119969841 TCTGAAGTATGCGCATGTAAGGG + Intergenic
1032059162 7:128709327-128709349 ACATAAGTATGTGCAAATAAAGG - Intronic
1034586157 7:152094335-152094357 ACTTAAGAATGTGCCCGTCAAGG + Exonic
1035157765 7:156928264-156928286 GCTCAAGTATGTGCACTAAGAGG + Intergenic
1036743531 8:11388467-11388489 GCTAAAGGATGTCCACCTAAAGG + Intergenic
1038271500 8:26079465-26079487 GCTTATGGATGAGCACATAAAGG + Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1043885111 8:85590008-85590030 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1044830080 8:96238663-96238685 GCTTAAGGATTTGCACATCAGGG - Intergenic
1045886760 8:107107852-107107874 TCTTAAGTATGTGCAAAGAAAGG - Intergenic
1052334397 9:27304961-27304983 GCTTATGTATATGCACATGAGGG - Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1058185244 9:101847054-101847076 GCTTATGTATGTGTAGATAATGG - Intergenic
1186035785 X:5421979-5422001 GCTCAAGCATGTGCACTAAAAGG - Intergenic
1188905770 X:35789429-35789451 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1189986062 X:46554291-46554313 GCTCAAGTATGTGCACTAAGAGG - Intergenic
1192103415 X:68289827-68289849 TATTAAGTATGTCCACTTAATGG + Intronic
1192284932 X:69725515-69725537 GCTTAAGTATGTAAAACTAAAGG - Intronic
1196262744 X:113603883-113603905 GCTTAAGCATGTGCATCTTATGG + Intergenic
1200492938 Y:3850711-3850733 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1201595417 Y:15662858-15662880 ACATAGGTATATGCACGTAATGG + Intergenic