ID: 1062775358

View in Genome Browser
Species Human (GRCh38)
Location 10:140810-140832
Sequence TTACAGTTGCATTGAGTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062775355_1062775358 27 Left 1062775355 10:140760-140782 CCCTTACGTGCACATACTTAAGC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1062775358 10:140810-140832 TTACAGTTGCATTGAGTATGTGG No data
1062775356_1062775358 26 Left 1062775356 10:140761-140783 CCTTACGTGCACATACTTAAGCT 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1062775358 10:140810-140832 TTACAGTTGCATTGAGTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062775358 Original CRISPR TTACAGTTGCATTGAGTATG TGG Intronic
No off target data available for this crispr