ID: 1062776080

View in Genome Browser
Species Human (GRCh38)
Location 10:149210-149232
Sequence GGAGATCCAAAGGGAGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062776080_1062776091 24 Left 1062776080 10:149210-149232 CCACACACTCCCTTTGGATCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data
1062776080_1062776086 -2 Left 1062776080 10:149210-149232 CCACACACTCCCTTTGGATCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1062776086 10:149231-149253 CCATCCCTGCACTGTGGCCTGGG No data
1062776080_1062776084 -3 Left 1062776080 10:149210-149232 CCACACACTCCCTTTGGATCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1062776084 10:149230-149252 TCCATCCCTGCACTGTGGCCTGG No data
1062776080_1062776083 -8 Left 1062776080 10:149210-149232 CCACACACTCCCTTTGGATCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1062776083 10:149225-149247 GGATCTCCATCCCTGCACTGTGG No data
1062776080_1062776092 27 Left 1062776080 10:149210-149232 CCACACACTCCCTTTGGATCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1062776092 10:149260-149282 TGTGAGGCAGAACACTGAGGTGG No data
1062776080_1062776089 11 Left 1062776080 10:149210-149232 CCACACACTCCCTTTGGATCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1062776089 10:149244-149266 GTGGCCTGGGAATTGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062776080 Original CRISPR GGAGATCCAAAGGGAGTGTG TGG (reversed) Intronic
900303413 1:1989432-1989454 TGAGGTCCAAAGGGAGTGGGTGG - Intronic
900571920 1:3362825-3362847 GGGGAGCCATAGGGAGTGTCGGG + Intronic
900948886 1:5846401-5846423 GGAGTCCCAAAGAGAGGGTGCGG + Intergenic
900969055 1:5979402-5979424 GAAGAACCACAGGGAGTTTGGGG + Intronic
902616075 1:17624244-17624266 CGAGGTCCCAAGGGAGTGTGGGG + Intronic
903027222 1:20438103-20438125 GGAGATGGAAATGGAGGGTGGGG - Intergenic
903372712 1:22847243-22847265 GGAGATGCAAAGACAGTTTGAGG + Intronic
905198861 1:36302921-36302943 GGAGATACAAAATGAGAGTGTGG + Intronic
905272340 1:36795265-36795287 GCAACTCCCAAGGGAGTGTGTGG + Intergenic
907811716 1:57877423-57877445 GAACAGCCAAAGGGTGTGTGTGG - Intronic
908586225 1:65572713-65572735 TGAGGTCCGAAGGGAGTGGGTGG + Intronic
908982663 1:69977580-69977602 GGAAATACAAAGGGAGGATGTGG - Intronic
909422618 1:75483891-75483913 GGAGAGATAAAGGGAGAGTGAGG + Intronic
909896313 1:81074649-81074671 GGAGAGCAAATGAGAGTGTGGGG - Intergenic
910259201 1:85279443-85279465 TGAGGTCCAAGGGGAGTGGGTGG + Intergenic
910485728 1:87711371-87711393 GGAGAGCCAAATGAAATGTGTGG - Intergenic
911455356 1:98115395-98115417 GAGGCTCCAAAGGGATTGTGTGG + Intergenic
914803973 1:150979306-150979328 GGAGAACCGAAGGAAGCGTGAGG - Intergenic
915475031 1:156148185-156148207 GGATGTCCAATGGGGGTGTGAGG + Intronic
915680324 1:157575631-157575653 GGAAACCGAGAGGGAGTGTGAGG + Intronic
915750845 1:158208946-158208968 GGAGATAGAGAGGGAGTTTGGGG - Intergenic
915831319 1:159133522-159133544 GGAGTTGCAGAGGGAGTGGGAGG - Intronic
915839363 1:159202532-159202554 GGAAATCAAAAGGAAGGGTGGGG - Intronic
919976428 1:202615891-202615913 AGAAATGCCAAGGGAGTGTGGGG - Intronic
923325081 1:232873752-232873774 GGAGAGCCCGAGGCAGTGTGAGG + Intergenic
1062776080 10:149210-149232 GGAGATCCAAAGGGAGTGTGTGG - Intronic
1067699831 10:48562624-48562646 GGAGGGGCAAAGGGAGTGGGAGG + Intronic
1073616029 10:104996924-104996946 GGAGATCCAGCGGGGATGTGTGG + Intronic
1073839455 10:107481915-107481937 TGAGGTCCAAAGGGAGTGGGTGG + Intergenic
1074143426 10:110696721-110696743 GGAGAGCCAAAGGGAATTTGAGG + Intronic
1075088531 10:119430058-119430080 GGAGAACCACATGGAGAGTGTGG + Intronic
1076283911 10:129275143-129275165 GGAGCTTCGAAGGGAGTGTAGGG - Intergenic
1076350363 10:129811182-129811204 GGAGCCCCAGAGCGAGTGTGTGG + Intergenic
1076503684 10:130957286-130957308 AGAAATCCAAATGGAGGGTGCGG - Intergenic
1077112580 11:868503-868525 GGAGATACAAGTGGTGTGTGCGG - Exonic
1077670948 11:4157211-4157233 AGAGATGGAAAGGGAGTGGGAGG + Intergenic
1077890473 11:6414594-6414616 GGAGGAGCAAAGGGAGTGTTTGG + Intronic
1078474598 11:11620442-11620464 GGGGGTCCAAAGGGAGGGTGGGG - Intronic
1078627132 11:12967989-12968011 GGAGCTTCAAAGAGGGTGTGGGG - Intergenic
1079968446 11:27006875-27006897 TGAGGTCCAAAGGGAGTGGTTGG - Intergenic
1080233635 11:30045291-30045313 TGAGGTCCGAAGGGAGTGGGTGG - Intergenic
1080268905 11:30429650-30429672 GGAGATCTAAATGCAATGTGAGG + Intronic
1080649526 11:34211075-34211097 GGAGACCCAAATAGAGTGTAAGG + Intronic
1081666594 11:44920305-44920327 GCAGGTCCAAAGGGAGGGAGGGG + Intronic
1083784669 11:64937106-64937128 GGAGAGCCAAAGGAAGCCTGTGG + Intergenic
1085053366 11:73390921-73390943 GGTAAGCCAAAGGGAGTGCGGGG + Exonic
1085204428 11:74722175-74722197 AGAGGACCAAAGGGAGTGTATGG - Intronic
1086221392 11:84448454-84448476 GAAGATCCAAAGGGATGGTATGG - Intronic
1086492469 11:87369408-87369430 GGAGATGCCAAGGCAGTGAGTGG - Intergenic
1086561525 11:88174946-88174968 AGAGATCCCAGGGGACTGTGCGG + Intronic
1088688061 11:112301298-112301320 TGAGAGCCAAAGGCAATGTGTGG - Intergenic
1088695875 11:112365548-112365570 TGAGGTCCTAAGGGAGTGGGTGG - Intergenic
1090058926 11:123447030-123447052 GGAGCTCCCAATTGAGTGTGTGG + Intergenic
1090513258 11:127397905-127397927 TGAGAACCAAAGGAAGGGTGAGG + Intergenic
1090761358 11:129839439-129839461 TGAGATAGAATGGGAGTGTGAGG - Intronic
1092893011 12:12986753-12986775 TGGCATTCAAAGGGAGTGTGGGG + Intronic
1094384410 12:29878458-29878480 GGAGAGACCAAGGGACTGTGGGG + Intergenic
1094495644 12:30987734-30987756 GGAGTGGCAAGGGGAGTGTGGGG + Intronic
1096152242 12:49322008-49322030 GGATATGTAAAGGGAGTGGGAGG + Intergenic
1096855010 12:54474528-54474550 GGAAAACCAAACGTAGTGTGAGG + Intergenic
1097727132 12:63088100-63088122 GGAGATACTGAGAGAGTGTGTGG + Intergenic
1102243649 12:111341603-111341625 GGAGATGCAGAAGGAGAGTGAGG + Intronic
1103563965 12:121806193-121806215 GGGGATCCCAAGGAAGAGTGAGG - Intronic
1105431716 13:20343184-20343206 GGAGGCCCACAGGGAGAGTGAGG - Intergenic
1111410272 13:87867450-87867472 GGAGTTTTAAAGGGAGTATGTGG + Intergenic
1112221479 13:97495474-97495496 TGAGGTCCAAGGGGAGTGGGTGG + Intergenic
1112378688 13:98867917-98867939 GGAGACCCAAAGGTAGTGCGGGG - Exonic
1113586787 13:111471246-111471268 GGAGTTCAGAGGGGAGTGTGGGG + Intergenic
1117189865 14:53278911-53278933 TGAGGTCCACAGGGAGTGGGTGG + Intergenic
1117342969 14:54807510-54807532 TGAGGTCCAAAGGGAGTGGGTGG + Intergenic
1117717723 14:58598014-58598036 GGAGGTACAGAGGGAGAGTGTGG + Intergenic
1117759669 14:59014188-59014210 TGAGGTCCAAAGGAAGTGGGTGG - Intergenic
1117906732 14:60597015-60597037 GGGGATCCAACGGGAGTGAGAGG - Intergenic
1117931135 14:60841172-60841194 GGAGATACAAAGGGAGGGAAAGG - Intronic
1117933604 14:60875272-60875294 GGATATTAAAAGGCAGTGTGTGG + Intronic
1119857077 14:77908833-77908855 GGAGAACCCCAGGGAGAGTGAGG + Intronic
1120601055 14:86510441-86510463 GAAGATGTAAATGGAGTGTGAGG - Intergenic
1122519802 14:102335362-102335384 TCAGCTCCAGAGGGAGTGTGGGG - Intronic
1123883383 15:24696871-24696893 TGAGGTCCTAAGGGAGTGGGTGG + Intergenic
1125078725 15:35651578-35651600 GGAGATACAGAGAGAGTTTGTGG + Intergenic
1125749208 15:42017274-42017296 TGAGGTCCCAAGGGAGAGTGTGG - Intronic
1126156789 15:45573489-45573511 GGAGAATCAAAGGGAGAGAGAGG + Intergenic
1127647255 15:60971234-60971256 GGAGATACAAATGCAGTGTTAGG - Intronic
1128234616 15:66059162-66059184 GGAGGACCAATGGGAGGGTGTGG + Intronic
1128374747 15:67066605-67066627 GGAGGTGGAAAGGGAATGTGAGG - Intronic
1129396414 15:75251079-75251101 GGATATCCAAAAAGAGAGTGTGG - Intergenic
1129922317 15:79329777-79329799 TGAGGTCCAAGGGGAGTGGGTGG - Intronic
1130244571 15:82233469-82233491 GGAGGGCAAAAGGGTGTGTGTGG - Intronic
1130585743 15:85180542-85180564 GGATATCCAAAGAGAGGATGTGG - Intergenic
1131187053 15:90283706-90283728 GGATATCCAAAAAGAGGGTGTGG - Intronic
1132019942 15:98352223-98352245 GGAGAGCCATAGGGAGTGGCGGG + Intergenic
1133014715 16:2934027-2934049 GGAGAGGGAAAGGCAGTGTGGGG - Intronic
1137885707 16:52101372-52101394 GCAAATCCAAATCGAGTGTGCGG + Intergenic
1138553747 16:57760592-57760614 GGAGTTACACAGGGTGTGTGTGG + Intronic
1140541213 16:75757867-75757889 GGACACCCCAAGGGAGTTTGGGG + Intronic
1140557578 16:75939241-75939263 TGAGGTCCAAGGGGAGTGGGTGG - Intergenic
1141315234 16:82956414-82956436 GGAGTTCCAAAGGGTGTGGCAGG - Intronic
1141315252 16:82956539-82956561 GGAGTTCCAAAGGGTGTGGCAGG - Intronic
1141379715 16:83565343-83565365 GGAAATCCCAAGGGCATGTGAGG - Intronic
1141708436 16:85683008-85683030 GGAGCTACACAGGGAGTTTGGGG - Intronic
1141884716 16:86883795-86883817 GGAGCTCCACAGGGAGTCTCTGG + Intergenic
1142020849 16:87781423-87781445 GGAAATCCAAAGCAAGTCTGGGG - Intergenic
1142283215 16:89160256-89160278 GGAGAGCCACAGGGGCTGTGGGG - Intergenic
1142371057 16:89682606-89682628 GGTGTTCCAAAGGTAGTTTGGGG + Exonic
1144412518 17:15014811-15014833 GGAGATGGAAAGGGAGTAGGTGG - Intergenic
1145325602 17:21821284-21821306 GGAGATAGAAAGGGACGGTGAGG + Intergenic
1146017594 17:29246548-29246570 GAAGATCCCAAGGTGGTGTGAGG + Intergenic
1149091798 17:52792052-52792074 GGAGTTCCAAGTGGAGTGAGAGG - Intergenic
1153950571 18:10054545-10054567 GGAGGGCCACAAGGAGTGTGAGG - Intergenic
1154311128 18:13266763-13266785 GCAGCTCCAAGGGTAGTGTGGGG - Intronic
1156024365 18:32634951-32634973 GGAGATGAGACGGGAGTGTGAGG + Intergenic
1157268069 18:46246306-46246328 GGAGCTCCCAAAGGAATGTGTGG + Intronic
1157483771 18:48072951-48072973 GGTCATCCTAAGGGAGAGTGGGG - Intronic
1159345781 18:67201248-67201270 GGAGATCCAAAGGCACCCTGTGG - Intergenic
1161200095 19:3009754-3009776 GGAGCTCCCAAGGCAGTGGGAGG - Intronic
1161394348 19:4037383-4037405 GAAGATCCTGAGCGAGTGTGAGG + Exonic
1164304338 19:23991081-23991103 TGAGAGCCAAGGGGAGTGGGTGG + Intergenic
1164615197 19:29663484-29663506 GGGAAACCAGAGGGAGTGTGGGG + Intergenic
1167603471 19:50467558-50467580 GGAGGCCCAGAGGGAGTGGGAGG - Intronic
1168546936 19:57260484-57260506 GGAGGTCCAAAAAGAGAGTGAGG - Intergenic
925456476 2:4020787-4020809 TGAGGTCCGAAGGGAGTGGGGGG - Intergenic
926683854 2:15683078-15683100 GGAGAACAAAAGTGAGGGTGAGG - Intergenic
926776412 2:16427950-16427972 GGAGATTCAAAGAGGGTGAGCGG - Intergenic
927773076 2:25880489-25880511 GGAAATCCAGAAGGAGGGTGGGG - Intergenic
928132721 2:28664766-28664788 TGAGATCCGAGGGGAGTGGGTGG - Intergenic
928477181 2:31640612-31640634 GGAGATCCAAAGGGATTATCTGG + Intergenic
929559446 2:42946650-42946672 GGAGGACCAAGGGGAGGGTGGGG - Intergenic
931387362 2:61809585-61809607 GGAGATCCGTAGGGAATTTGGGG + Intergenic
932538916 2:72630256-72630278 GGAGATCCAGAGAGCATGTGGGG - Intronic
932604486 2:73156143-73156165 AGAGAACCCAAGGGAGCGTGTGG - Intronic
934145716 2:89091918-89091940 GGAGATCTAAAGGGAATGTTGGG + Intergenic
935115756 2:100134979-100135001 AGAGACCTAAAGGGAGTGAGAGG + Intronic
935234162 2:101124135-101124157 GGAGATCCAGTGGCAGTGGGAGG - Intronic
935944960 2:108277368-108277390 GGAGTTCCCAAGGCAGTGTTTGG - Intergenic
936516198 2:113183020-113183042 GGAGGTCCACAGGGGGCGTGGGG - Exonic
936766103 2:115850210-115850232 TGAGATCCAAAGGCAGTGGGTGG - Intergenic
938313583 2:130311267-130311289 GGGAATCCAGAGGGAGTGAGGGG - Intergenic
939028826 2:137046371-137046393 TGAGATCTAAAGGGTGAGTGGGG + Intronic
939100185 2:137886911-137886933 GGAGAGCAAAAGAGAGAGTGAGG + Intergenic
942352005 2:175062766-175062788 TGAGGTCCAAAGGGAGTGGGTGG + Intergenic
946178267 2:217935157-217935179 GGAGATCTGAAGGCAGGGTGAGG + Intronic
946621791 2:221570538-221570560 GGAGATCCAGAGGGCGAGAGAGG + Intronic
947446604 2:230168787-230168809 GGAGAGCCAAATGCAGTGTGTGG + Intronic
948396745 2:237650302-237650324 AGAGATCCGAAGGAAGAGTGGGG + Intronic
948420457 2:237857019-237857041 GGAAACCCAAAGAGAGTCTGGGG - Intergenic
1169091650 20:2864658-2864680 TGAGATCCATGGGGCGTGTGGGG + Intronic
1170609881 20:17903901-17903923 GGAGACCCCAAAGGAGTGAGTGG + Intergenic
1173573873 20:44097421-44097443 TGAGGTCCAAGGGGAGTGGGCGG + Intergenic
1173879893 20:46404396-46404418 GGAGGTGCAAAGGAAGTTTGAGG - Intronic
1174320707 20:49739427-49739449 GGAGGTAGAAATGGAGTGTGGGG + Intergenic
1175317490 20:58059230-58059252 GGAGAGCCTGAGTGAGTGTGGGG - Intergenic
1180859436 22:19068918-19068940 GGAGGACAAAAGAGAGTGTGTGG - Intronic
1181275476 22:21685155-21685177 GAAGAACCAAGGGGTGTGTGGGG + Intronic
1181457326 22:23067145-23067167 AGAGATCCAATGGGATTGAGGGG + Intronic
1182438239 22:30345192-30345214 TAAGATGCAAAGGGAGTATGAGG + Intronic
1183009459 22:34932873-34932895 GCAGAGCCAAAGTGAGGGTGAGG + Intergenic
1183519326 22:38287407-38287429 GGAGGTCCAAACGGAGTGGGAGG - Intergenic
1183890338 22:40922372-40922394 AGAGATCCAAAGAGATTGTTTGG + Exonic
1184030847 22:41893616-41893638 GGAGACACAAAGGATGTGTGAGG + Intronic
1184663893 22:45977556-45977578 GGAGAGGCAATGGGAGTGGGTGG - Intergenic
1184875172 22:47269794-47269816 GGAGCTGGAGAGGGAGTGTGTGG - Intergenic
1184954368 22:47874086-47874108 GGAGATCTAGAGGGGGTGGGGGG - Intergenic
949439928 3:4069592-4069614 TGAGATTTAAAGGGAGTGTGAGG + Intronic
950841554 3:15973193-15973215 TGAGGTCCAAGGGGAGTGGGTGG + Intergenic
953210448 3:40870484-40870506 GGAGAAGCAAAGGGAGTTGGAGG + Intergenic
953320192 3:41964358-41964380 TGAGGTCCAAGGGGAGTGGGTGG - Intergenic
953515258 3:43584616-43584638 TGAGGTCCAAAGGGAGTGGGTGG - Intronic
955016384 3:55074113-55074135 GGAGAATGCAAGGGAGTGTGGGG + Exonic
955331295 3:58049758-58049780 GGAGCTGCAAAGGGGGTGTCAGG + Intronic
959658035 3:108832289-108832311 AGAGATCCAAAAAGAGTGTTGGG - Intronic
960909128 3:122631108-122631130 GCAGATCCAAAAGGACTGTAAGG + Intronic
966228377 3:177623120-177623142 AGATCTGCAAAGGGAGTGTGGGG + Intergenic
967721684 3:192822443-192822465 GGATATCCAAAAGGGGTGGGAGG - Intronic
967795651 3:193596127-193596149 TGGTATCCAAAGGGAGTGGGAGG - Intronic
969834792 4:9831876-9831898 TGAGGTCCGAAGGGAGTGGGTGG - Intronic
971370712 4:26016544-26016566 AGAGATACAAAGGGGCTGTGGGG + Intergenic
972991915 4:44830898-44830920 TGAGGTCTAAAGGGAGTGGGTGG - Intergenic
974819903 4:67052910-67052932 TGAGCACCAAAGGAAGTGTGAGG + Intergenic
976286867 4:83379013-83379035 TGAGGTCCAAGGGGAGTGGGTGG - Intergenic
976704003 4:88002998-88003020 GGAAATCCAAAAGGAGTTTCTGG - Intergenic
977664842 4:99634150-99634172 GAAGATCCAAGGGGAGTCGGTGG - Intergenic
981075661 4:140588797-140588819 TGAGGTCCGAAGGGAGTGGGTGG + Intergenic
984959788 4:185085750-185085772 AGGAATGCAAAGGGAGTGTGAGG - Intergenic
986249323 5:6042436-6042458 GGAGATACAAAGGGAATGCTTGG + Intergenic
986294275 5:6424208-6424230 GGGGATCCACAGTCAGTGTGTGG + Intergenic
986521980 5:8629087-8629109 TGAGGTCCGAAGGGAGTGGGTGG - Intergenic
987059439 5:14228021-14228043 GGGGATTCAGAGGGAGGGTGTGG + Intronic
990338102 5:54794699-54794721 GGAAATCCAAATAGAGTGTGCGG + Intergenic
991120558 5:63008436-63008458 GGCCAGCCACAGGGAGTGTGGGG - Intergenic
991144535 5:63285074-63285096 GGAGATCAGAAAGGAGAGTGAGG + Intergenic
992992046 5:82293831-82293853 GGAGAAGAAAAGGGAGTATGAGG + Intronic
993074194 5:83206534-83206556 GGAGTTTCAAAGGGAATGGGAGG + Intronic
996065111 5:119071214-119071236 CGAGGTCCAGAGGAAGTGTGTGG + Intronic
998163831 5:139829004-139829026 GTAGATCCAAATGGGGTGGGAGG + Intronic
998232745 5:140371720-140371742 GGAGAGCCACAGCGAGTGAGAGG - Intronic
998527349 5:142854935-142854957 GGAGAACAAAAGGGACTGGGGGG - Intronic
999554529 5:152725810-152725832 GGACATCCAAAGTTAGTTTGAGG - Intergenic
999797790 5:155004422-155004444 GAAGCTCCAGAGGGAGTGTTAGG + Intergenic
999833129 5:155339680-155339702 GGAGATCCAAAGGCAATTTAAGG - Intergenic
1000381631 5:160634887-160634909 AGAGATCTAAAGGGAGTCAGAGG - Intronic
1001132052 5:169072482-169072504 CCAGCTCCAAAGGGACTGTGAGG + Intronic
1001447352 5:171795845-171795867 GGAGAACCTGAGGGAGTATGAGG - Intergenic
1001846319 5:174924580-174924602 GGATATCCAAAAAGAGAGTGTGG + Intergenic
1003535231 6:6970460-6970482 GGACCTCCAAAGAGAGCGTGAGG + Intergenic
1003581859 6:7347485-7347507 AGGGATCCAAAGCGAGGGTGGGG + Intronic
1003972656 6:11313708-11313730 TGAGATCCAAAGAGAGTGAGAGG - Intronic
1004163721 6:13236910-13236932 GGAGATGAATAGGGAGTGTTAGG + Intronic
1004199079 6:13531301-13531323 GCAGATCCAGTGGGAGGGTGTGG - Intergenic
1004399634 6:15276462-15276484 GGAGAGCCAAAGGAGGTCTGGGG + Intronic
1005696521 6:28356951-28356973 TGAGGTCCAAGGGGAGTGGGTGG + Intronic
1006610648 6:35292442-35292464 GGAGAGCCAGAGGGAGGGAGAGG - Intronic
1006829208 6:36958632-36958654 GGTGACCCAAGGGGAGGGTGGGG + Intronic
1009909279 6:69905217-69905239 TGAGATCTGAAGGGAGTGGGTGG + Intronic
1013624856 6:111926871-111926893 GGAGATCCAAAGGTAATGTGAGG - Intergenic
1014753099 6:125274409-125274431 TGAGGTCCAAAGGGAGTTGGTGG - Intronic
1018247063 6:161833601-161833623 GGACATCCGAGGGGAGTCTGTGG - Intronic
1018909196 6:168092251-168092273 GGAGATGCACAAGGACTGTGGGG - Intergenic
1020746901 7:12090524-12090546 TGAGGTCCAAGGGGAGTGGGTGG - Intergenic
1022114918 7:27252852-27252874 GGAGAGCGAAAGAGAGTGGGAGG + Intergenic
1024338950 7:48237751-48237773 GGAGATCCACAGAGGATGTGAGG - Intronic
1024590974 7:50882925-50882947 GGGGATCAGAAGGGAGGGTGAGG + Intergenic
1024850960 7:53716443-53716465 GGTGCTCCAAAAGGAGGGTGAGG - Intergenic
1027139610 7:75647941-75647963 GCAGATACACAGGGAGGGTGAGG + Intronic
1029295587 7:99537876-99537898 TGAGGTCCAAAGGGAGTGAGTGG - Intergenic
1032503181 7:132415177-132415199 GGAGGTCCGAAGGGAGTTGGCGG + Intronic
1032854532 7:135823454-135823476 GAAGATCCAAAGGTAGTTTTAGG + Intergenic
1035113756 7:156505924-156505946 GGAGGTCCCAGGGGAGTCTGGGG + Intergenic
1035233638 7:157482906-157482928 GGAGCCCCAAAGGGAGAGAGAGG - Intergenic
1037700222 8:21267118-21267140 GGTGGGCAAAAGGGAGTGTGGGG - Intergenic
1038242303 8:25821187-25821209 GGAGAGCCAGATGCAGTGTGAGG + Intergenic
1039012418 8:33109237-33109259 GGATTTCCAAATTGAGTGTGGGG - Intergenic
1041004155 8:53483319-53483341 TGAGGTCCGAAGGGAGTGGGTGG - Intergenic
1041991767 8:64001301-64001323 TGAGGTCCGAAGGGAGTGAGTGG - Intergenic
1042714897 8:71761971-71761993 TGAGGTCCAAGGGGAGTGGGTGG + Intergenic
1043363979 8:79510183-79510205 GGAGGGCCAAAGAGAGAGTGGGG + Intergenic
1045035388 8:98172859-98172881 GGAGATCTAGAGTGAGTGTGGGG + Intergenic
1045281621 8:100754362-100754384 GGAGAACCATAGGGAGAGAGTGG - Intergenic
1045710330 8:104975620-104975642 GGAGAGAGAAAGGGTGTGTGGGG - Intronic
1047608862 8:126501296-126501318 GAAGTTCCAAAGAGAGTGTTAGG - Intergenic
1048162467 8:132033718-132033740 GGAGATCCAGAGAGAGTGTCAGG - Intronic
1049320120 8:141991832-141991854 GGAGTTCCAGAGGCACTGTGGGG - Intergenic
1049493004 8:142914964-142914986 GGAGGACTGAAGGGAGTGTGGGG - Intronic
1049645070 8:143732521-143732543 TGAAATCCAAAGGGACAGTGGGG - Intronic
1052490557 9:29161339-29161361 TGAGGTCCAAGGGGAGTGGGTGG - Intergenic
1055005881 9:71505559-71505581 GGACATGCAAGGAGAGTGTGAGG - Intergenic
1055361888 9:75500445-75500467 AGAGATGCAAAGGCCGTGTGAGG - Intergenic
1057183605 9:93043164-93043186 GTTGATTTAAAGGGAGTGTGAGG + Intergenic
1058982298 9:110181456-110181478 TGAGGTCCGAAGGGAGTGGGTGG - Intergenic
1060047276 9:120350863-120350885 GGGGAGCCAGAGAGAGTGTGAGG + Intergenic
1060878762 9:127103009-127103031 GGAGAAGCACAGGGTGTGTGTGG - Intronic
1062324032 9:136004019-136004041 GGAGCCCCAAGGGGAGGGTGTGG + Intergenic
1062711976 9:137980026-137980048 GGAAAAGCAAAGGGAGTGAGAGG - Intronic
1188456698 X:30374343-30374365 AAAGTTCCAAAGGGAATGTGAGG - Intergenic
1188850890 X:35130903-35130925 GGCGATCCAAAGGGAAGGTGAGG + Intergenic
1192200398 X:69062894-69062916 GGAGAGCCCTAGGGAGTGAGTGG - Intergenic
1192509295 X:71712510-71712532 GGAGACGCACAGGGAGTATGGGG + Intergenic
1192511425 X:71722652-71722674 GGAGACACAGAGGGAGTATGGGG - Intergenic
1192515272 X:71758853-71758875 GGAGACACAGAGGGAGTATGGGG + Intergenic
1192517402 X:71769043-71769065 GGAGACGCACAGGGAGTATGGGG - Intergenic
1192576139 X:72244778-72244800 GGAGATCAAAAGTGGGTTTGGGG + Intronic
1194857923 X:98956808-98956830 GGAGATAAAAAGGAAGAGTGGGG - Intergenic
1195279396 X:103316545-103316567 AGAGATAGAAAGGGAGTTTGGGG + Intergenic
1195843347 X:109198557-109198579 GGAGATTGAGAGAGAGTGTGAGG - Intergenic
1196058709 X:111384928-111384950 TGAGATCCAAAGAGAGGTTGTGG + Intronic
1197467985 X:126830054-126830076 GTAGACTCAAAGGGAATGTGAGG - Intergenic
1199165352 X:144666942-144666964 GGAGAACCAGAGAGATTGTGTGG - Intergenic
1200231615 X:154446544-154446566 GGAGATGGAAAGGGAAGGTGAGG + Exonic