ID: 1062776081

View in Genome Browser
Species Human (GRCh38)
Location 10:149219-149241
Sequence TGCAGGGATGGAGATCCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062776081_1062776089 2 Left 1062776081 10:149219-149241 CCCTTTGGATCTCCATCCCTGCA No data
Right 1062776089 10:149244-149266 GTGGCCTGGGAATTGCTGTGAGG No data
1062776081_1062776092 18 Left 1062776081 10:149219-149241 CCCTTTGGATCTCCATCCCTGCA No data
Right 1062776092 10:149260-149282 TGTGAGGCAGAACACTGAGGTGG No data
1062776081_1062776091 15 Left 1062776081 10:149219-149241 CCCTTTGGATCTCCATCCCTGCA No data
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062776081 Original CRISPR TGCAGGGATGGAGATCCAAA GGG (reversed) Intronic
No off target data available for this crispr