ID: 1062776082

View in Genome Browser
Species Human (GRCh38)
Location 10:149220-149242
Sequence GTGCAGGGATGGAGATCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062776082_1062776092 17 Left 1062776082 10:149220-149242 CCTTTGGATCTCCATCCCTGCAC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1062776092 10:149260-149282 TGTGAGGCAGAACACTGAGGTGG No data
1062776082_1062776091 14 Left 1062776082 10:149220-149242 CCTTTGGATCTCCATCCCTGCAC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data
1062776082_1062776089 1 Left 1062776082 10:149220-149242 CCTTTGGATCTCCATCCCTGCAC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1062776089 10:149244-149266 GTGGCCTGGGAATTGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062776082 Original CRISPR GTGCAGGGATGGAGATCCAA AGG (reversed) Intronic
902556382 1:17249275-17249297 CTGCAGGGAGGAAGGTCCAAGGG - Intronic
903167555 1:21531537-21531559 GTCCTGGGATAGAGAGCCAAAGG + Intronic
904334858 1:29790215-29790237 ATGCAGGGAAGAAGATCCAAGGG - Intergenic
904409702 1:30318130-30318152 CTGCAGGGATGGAGACACATAGG + Intergenic
905226531 1:36482660-36482682 GTCCAGGGCTGGGGTTCCAAAGG + Intronic
905797661 1:40824565-40824587 GTGCAGGGATGGAGGAGTAAGGG - Intronic
906797636 1:48710643-48710665 GAGCAGGGATGGAGAATGAATGG - Intronic
908092928 1:60705650-60705672 GTGCAGGGATTGAGGTACTATGG - Intergenic
909824212 1:80105836-80105858 GGGCAGGTAAGGAGATCCTAAGG + Intergenic
912236407 1:107855934-107855956 GTGCAGTGCTTGAGGTCCAAAGG + Intronic
912447977 1:109751901-109751923 GTCCAGGGATGGAGCTGCCAAGG - Intronic
912519210 1:110233861-110233883 GAGCAGGGAGGGAGGGCCAAGGG - Exonic
916896898 1:169172914-169172936 GTTCAGGGATTGAAATCTAATGG - Intronic
917715601 1:177734231-177734253 GTGCAGGGATGGAAAACCTTGGG - Intergenic
918091629 1:181300155-181300177 GTGCAGGGATGGAGTTTTGATGG + Intergenic
918203669 1:182290393-182290415 ACACAGGGAAGGAGATCCAAGGG - Intergenic
918753195 1:188300014-188300036 GTGCAGCGAGGGAGCTCCATGGG + Intergenic
924090761 1:240498602-240498624 GTGCAGGGATGATGAGCGAACGG - Intronic
1062776082 10:149220-149242 GTGCAGGGATGGAGATCCAAAGG - Intronic
1063214419 10:3911502-3911524 GTGCAGAGAGGGACACCCAAAGG + Intergenic
1063341316 10:5266419-5266441 GAGCAGGGAGGGAGAGCTAATGG + Intergenic
1065187362 10:23181348-23181370 TGGCTGGGATGGAGATACAATGG + Intergenic
1069877342 10:71571196-71571218 GTGGAGGGATGGGGATCCCATGG + Intronic
1070013379 10:72498670-72498692 GAGCAGAGAAGGAGAACCAAGGG + Intronic
1070089405 10:73270021-73270043 GTGCAAGGTTGGAAATCCACAGG + Intronic
1070555589 10:77525401-77525423 GTGCAGGGTTGGAGACTCAATGG + Intronic
1073480095 10:103780961-103780983 GTGCAGGGACGGACAAGCAAGGG - Intronic
1073639779 10:105240099-105240121 GTGCAGGGATGCAGGGCAAAGGG - Intronic
1075679536 10:124322517-124322539 TTGCAGAGATAGAGAGCCAAGGG - Intergenic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1078099221 11:8319862-8319884 GTGCAGTGGTGAAAATCCAAGGG - Intergenic
1083671095 11:64300250-64300272 GTGCAGGGAGGGAGAGGCAGGGG + Intergenic
1083940496 11:65892895-65892917 GAGGAGGGTTGGAGAGCCAAGGG + Exonic
1086188030 11:84042890-84042912 GTGCAGGGAGGGAGAGCAACAGG + Intronic
1087261551 11:96017825-96017847 GTGCAGGGGTGGAGAAGCAGGGG + Intronic
1088596742 11:111446780-111446802 GTGCAGGGAAGGACACTCAAGGG + Intronic
1088735501 11:112724728-112724750 GTGCAGGGAAGGAGAGCCCCAGG - Intergenic
1089669020 11:120039554-120039576 GGGCAGGCCTGGAGATCCAGAGG - Intergenic
1091172576 11:133531656-133531678 GGGCAGGGAAGGAGCTCCAGGGG + Intronic
1091698835 12:2646545-2646567 GGGCAGGGAGGGAGGTCCAGAGG - Intronic
1092020480 12:5198449-5198471 TTCCAGGGATGGAGATCAAGTGG + Intergenic
1092936481 12:13368514-13368536 GTGCAGGGAGGGGCAGCCAAGGG + Intergenic
1098797052 12:74902918-74902940 GTGCAGGGATGCAGATGAGAGGG - Intergenic
1101907177 12:108835751-108835773 GTGCAGGGAGGGGGCTGCAAGGG + Intronic
1105045697 12:133001610-133001632 CTGCAGGGAGGGAGACCCCAGGG - Intronic
1106499346 13:30312092-30312114 CTGAAGGGCTGGAGATCAAAGGG - Intergenic
1106904876 13:34395341-34395363 GAGCAGGCTTTGAGATCCAAGGG - Intergenic
1109684998 13:65806631-65806653 GTGAAGGGATGCAGATGCTAGGG - Intergenic
1113642399 13:111967183-111967205 GTCCAGGGATGAAGGTCCCAAGG + Intergenic
1113772029 13:112916582-112916604 GTGCAGGGGTGGAGCTCAACAGG - Intronic
1114084358 14:19228785-19228807 GTGCAGGCATGGAGATTCTGGGG + Intergenic
1115546039 14:34465561-34465583 GTGAAGGGAAGGAGATAGAATGG + Intergenic
1116647463 14:47547337-47547359 GTGCAAGGATGAAAAACCAAGGG - Intronic
1117871852 14:60209442-60209464 GTGCAGGAATGGAGATCATCAGG - Intergenic
1119727784 14:76932634-76932656 GTAGAGGGATGCAGATCAAAGGG - Intergenic
1121890443 14:97585228-97585250 GTGCAGGGACGGAGAGAGAAGGG + Intergenic
1122136348 14:99635140-99635162 CTGCAGGGGTGGAGGTCCCAGGG + Intergenic
1122143666 14:99676527-99676549 GAGCAGGGATGGGGATGGAAAGG - Exonic
1122505000 14:102226690-102226712 GTGCAGGGCGGGAAGTCCAAGGG + Intronic
1122816107 14:104314873-104314895 GTGCAGGGCTGGGCATCCAATGG - Intergenic
1122882569 14:104696682-104696704 GTGCAGTCCTGGAGATCCATGGG + Intronic
1202895964 14_GL000194v1_random:10646-10668 GTGCAGGCATGGAGATTCTGGGG + Intergenic
1123932913 15:25180471-25180493 GTGCAGGGAGGGGGATGCACTGG + Intergenic
1124443503 15:29707542-29707564 TTGCAGGCAGGGAGAACCAAAGG - Intronic
1127461594 15:59204246-59204268 GCGCAGGGATGGAGAGCAGAGGG + Intronic
1127761721 15:62146230-62146252 GAGAAGGGATGTAGATCCTAAGG - Intergenic
1128131067 15:65227530-65227552 GTGCAGTGAAGGAGATAAAAAGG - Intergenic
1129558990 15:76545697-76545719 GTGAAGGGAAGGAGATGCAAAGG + Intronic
1129652179 15:77498831-77498853 GTGGAGAGATGGAGATCCGAAGG - Intergenic
1131293742 15:91129515-91129537 GTGCATGGATGAAGCTGCAAGGG + Intronic
1133560417 16:6945407-6945429 ATGCAGGAATGTAGATCCAATGG + Intronic
1134359864 16:13521239-13521261 GAGCAGGGAAGAAGATTCAAGGG - Intergenic
1135938948 16:26804222-26804244 GTGCAGGAATGAAGAGCCAGTGG + Intergenic
1136119401 16:28121443-28121465 GAGCTGGGATGGAGATTCTATGG - Intronic
1140121324 16:72085345-72085367 GTGCAGAGCTGGAGAGCCATGGG - Exonic
1141133935 16:81453610-81453632 CTGCAGGGAAGGAGAGCCACGGG + Intronic
1142273106 16:89101246-89101268 GAGCAGGGATGGAGGAACAAGGG + Exonic
1144120857 17:12150974-12150996 TTCCTGGGATGGAGATCCAGGGG + Intergenic
1145975443 17:28981465-28981487 GCGCAGGGATCGGGATCCAGGGG - Exonic
1147386964 17:40088685-40088707 GAGCAGGGATGGGGAGGCAAGGG - Intronic
1147777604 17:42913890-42913912 GTGCAGGGTTCGACCTCCAAAGG + Intergenic
1147846908 17:43410909-43410931 GTCCAGAGATGGAGAGCCATTGG + Intergenic
1149552882 17:57553119-57553141 CTGCGGGGATGGACAACCAAAGG - Intronic
1150506592 17:65704690-65704712 GTGCAGAGGTGGAGATCCTCAGG + Intronic
1150634990 17:66906640-66906662 GTGCAATGATGAAGATGCAATGG + Intergenic
1151239114 17:72744050-72744072 ATGGAGGGATGGAGTTGCAAGGG - Intronic
1151675455 17:75595145-75595167 GTGCAGGGATGGAGAGGTAAAGG + Intergenic
1152539383 17:80967368-80967390 GTGCAGGGATTGGGAGCCAGGGG + Intergenic
1155437341 18:25827001-25827023 GTGCTGGGATGGAGAGCGCAGGG + Intergenic
1159279096 18:66260915-66260937 CTTCAGGTATGAAGATCCAAAGG - Intergenic
1160416672 18:78716858-78716880 GAGCAGGGATGGAGACCTAAGGG - Intergenic
1160722692 19:604348-604370 GTGCAGGGGTGGAGCTACAATGG + Intronic
1161620408 19:5294078-5294100 AGGCCGGGATGGAGACCCAAGGG + Intronic
1162948770 19:14058462-14058484 GTGCAGAGATGGGGATCAAAAGG + Intronic
1164779063 19:30878179-30878201 GTAGAGGGATGGAGATGGAAAGG - Intergenic
1164779261 19:30879417-30879439 GTAGAGGGATGGAGATGGAAAGG + Intergenic
1166917140 19:46203164-46203186 GGGCAGGGATGGGGATCACAAGG + Intergenic
1168282326 19:55312194-55312216 CTGCAGGGATGGGGCTCCACAGG + Exonic
1168429133 19:56263460-56263482 TTACAGGGATGGAGTTGCAAAGG + Intronic
1168490902 19:56808155-56808177 GGGCAGGGATGGTGATCAGAAGG + Intronic
928469871 2:31563528-31563550 GTACAGGGAAGGGGATCCCAGGG + Intronic
931407295 2:61991537-61991559 GTGCAGGGATAGAGATATTAGGG + Intronic
932785895 2:74603637-74603659 GTACAGGGATGGAGATAGAAAGG + Intronic
935696746 2:105776976-105776998 GTGAAGGGCTGGACAGCCAAAGG + Intronic
936870523 2:117130787-117130809 GGGCAGGGATGGGGATCACAAGG - Intergenic
938086838 2:128407394-128407416 TTCCAGGGATGCAGATCCACGGG - Intergenic
940296390 2:152129639-152129661 GTGCACGGATGCAGAACCCATGG - Intronic
942895858 2:181053592-181053614 GTGCAGGGGCAGAGATACAAGGG - Intronic
944250218 2:197574005-197574027 CTGCAGGGATGGAGCCCTAATGG + Intronic
947708407 2:232294546-232294568 GTCAAGGAATGGAGAGCCAAGGG - Intronic
1172015360 20:31869904-31869926 GTGCAGGGATGGAAATTCTGGGG + Intronic
1172717375 20:36975251-36975273 GGGCAGGGAAGAAGATCAAAGGG - Intergenic
1172811983 20:37654684-37654706 CTGCAGGGATGGAGCTCTCATGG - Intergenic
1173531309 20:43771876-43771898 GTGCAGGAATGGAAATACAATGG - Intergenic
1173561707 20:44010766-44010788 ATGAAGGGATGGAGACCCCAAGG + Intronic
1175884804 20:62283726-62283748 GGGAAGGGATGGAAACCCAAAGG - Intronic
1176615653 21:9026698-9026720 GTGCAGGCATGGAGATTCTGGGG + Intergenic
1177294770 21:19160369-19160391 GTGCAGAGATTGTGATCCGATGG - Intergenic
1178394722 21:32232927-32232949 GAGCAGAGATGGAGAATCAATGG + Intergenic
1179596565 21:42446590-42446612 ATGAAGGGATGGAGGTCTAAAGG + Intronic
1179838955 21:44057947-44057969 GTGCAGTAATGGAGATCAGAAGG + Intronic
1180293614 22:10864417-10864439 GTGCAGGCATGGAGATTCTGGGG - Intergenic
1180496419 22:15893832-15893854 GTGCAGGCATGGAGATTCTGGGG - Intergenic
1180957793 22:19748811-19748833 CTGCAGGGATGGAAATTGAAGGG - Intergenic
1181149123 22:20870153-20870175 GGGCAGGGAGGGAGAGGCAAAGG + Intronic
1181547439 22:23610041-23610063 GTGCAGGGATTCAGAACCAGAGG - Intronic
1182464640 22:30506737-30506759 CTGCAGGGGTGGAGATCCTAGGG + Intergenic
1183613208 22:38924801-38924823 GTGCTTGGAGAGAGATCCAAAGG - Intergenic
950939951 3:16883432-16883454 CTCCAGGGAGGGAGATCCAGGGG + Intronic
952173029 3:30830319-30830341 CTTCAGAGATGAAGATCCAAAGG - Intronic
953726105 3:45400590-45400612 GTGCTGGGGTGGAGATCAGATGG + Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
955246189 3:57227545-57227567 GTGCAGGGAAGGCCATCCCAGGG + Intergenic
956929537 3:74027358-74027380 GTGCAGGGATGCAGTTACACTGG - Intergenic
964404859 3:156338696-156338718 GGTCAGGGATAGAGACCCAATGG - Intronic
966157598 3:176933918-176933940 GTGCAGGGATGCAGTTACACTGG - Intergenic
967182041 3:186913691-186913713 GTGAAGGGAAGTAGATACAATGG - Intergenic
968627623 4:1634308-1634330 GGGCAGGGATGGAGCTCAGAGGG - Intronic
969124648 4:4937685-4937707 GTGCAGAAATGGAAATCCACTGG + Intergenic
969556759 4:7916820-7916842 GTGCAAGGAGGGAGGTCCCAGGG - Intronic
970246918 4:14073248-14073270 TGGCAGAGATAGAGATCCAAAGG - Intergenic
970853537 4:20629955-20629977 GGGCAGGGATGGAGGTCACAAGG + Intergenic
975621342 4:76299884-76299906 GTGCAGGGATGGAGAACAGCAGG + Intronic
980063478 4:128156173-128156195 GAGGAGGGTTGGAGAGCCAAGGG - Intronic
981882466 4:149631253-149631275 GTACAGGGATTGAAATCCACAGG - Intergenic
987431115 5:17834540-17834562 GTGTAGGGATGGGGAGGCAAGGG - Intergenic
987777246 5:22383909-22383931 TTTCAGGGATGAATATCCAATGG + Intronic
989513093 5:42310966-42310988 GCACAGGGAAGGTGATCCAAAGG + Intergenic
990020345 5:51118853-51118875 GCGCAGTGATGAAGATACAAGGG - Intergenic
993030056 5:82695238-82695260 GAGTAGGGATGGAAACCCAAGGG - Intergenic
994100518 5:95886503-95886525 GTACAGGGTAGGAGCTCCAATGG + Exonic
995082126 5:108064451-108064473 AAGCAGGGATGGAGATGCCAAGG + Intronic
996888903 5:128393330-128393352 TTGCATGGATGGACTTCCAATGG - Exonic
996918455 5:128738001-128738023 GTGCAGTGATGGTGAGCCAGAGG - Intronic
998023939 5:138796932-138796954 CTGCAGGGAAGAAGATTCAATGG - Intronic
1000172662 5:158718374-158718396 GTGAAGGTATGGAGATAGAAAGG - Intronic
1001048507 5:168394761-168394783 GTGAAGGGATGCAGACACAAAGG + Intronic
1001193524 5:169651892-169651914 GTGCAGGAAAGGAGATTTAAAGG + Intronic
1002966409 6:1970704-1970726 GTGGGAGGATAGAGATCCAAAGG + Intronic
1007335196 6:41150633-41150655 GGGGAGGGAAGGAGATTCAATGG - Intronic
1007596376 6:43053577-43053599 GGGCAGGGAAGGAGAAGCAAGGG + Intronic
1007715940 6:43856229-43856251 GAGCAGGGATGGAGATGAGAGGG + Intergenic
1007958474 6:45938101-45938123 GTGCAGAGCTGAAGATCCAGAGG + Intronic
1008155041 6:48003505-48003527 GAGCAGGGATGGTGATAAAAAGG - Intronic
1010295809 6:74194616-74194638 CTCCTGGGATGGAGATCCCAGGG - Intergenic
1012823870 6:104123755-104123777 CTGCAGGGATGGAGATTTCATGG + Intergenic
1013341174 6:109217623-109217645 GTGCAAGGCTGTACATCCAAGGG + Intergenic
1016282962 6:142440202-142440224 ATGCAGAGATGGAGGTCCAAAGG + Intronic
1016512970 6:144864076-144864098 GTGCAGGGATGGAGCCCTTATGG + Intergenic
1017055156 6:150430052-150430074 CTCCAGGGGTGGAGATGCAAGGG - Intergenic
1018676603 6:166227613-166227635 GTGCAGGGATGGCCTCCCAATGG - Intergenic
1019606448 7:1912579-1912601 GTGCAGGGATGGGGAGCACAGGG - Intronic
1020461280 7:8433009-8433031 GGGCAGGCTTGGAGATGCAATGG + Intergenic
1021551172 7:21872547-21872569 GTGCTGGGAGGGAGATATAAAGG - Intronic
1022977545 7:35573113-35573135 GTTAAGGGGTGGAGTTCCAAAGG + Intergenic
1023728122 7:43164691-43164713 GTGGAGGGAGGGAGAAGCAATGG + Intronic
1024680347 7:51680528-51680550 GTTCAGAGAGGGAGACCCAACGG - Intergenic
1025615268 7:63112653-63112675 GGGCAGGGATTGACACCCAAGGG + Intergenic
1029238600 7:99143405-99143427 GGCCAGGGAAGGAGATGCAAGGG + Intronic
1031131778 7:117841427-117841449 GTGAAAGGATGGAGATGAAAGGG - Intronic
1031278923 7:119770073-119770095 ATGGGGGGATGGTGATCCAAGGG + Intergenic
1034936507 7:155203791-155203813 GTGCAGCCATGGAGACCCCACGG - Intergenic
1035787144 8:2270441-2270463 GTTCAGGGATGAAGACCCACAGG - Intergenic
1035805663 8:2451275-2451297 GTTCAGGGATGAAGACCCACAGG + Intergenic
1038265169 8:26033600-26033622 GTGCAGGGAGGGAGAGCCTCAGG + Intronic
1044619744 8:94177193-94177215 GTGCTGGGATGGAGCTCCTTTGG - Intronic
1045252648 8:100494471-100494493 GTGCAGGGATGGAGAATACAGGG + Intergenic
1045376339 8:101578218-101578240 CTGCAGGGCTGGAGAATCAAAGG + Intronic
1045405156 8:101858760-101858782 GTGCAGGAATGGAGCTCCTTGGG - Intronic
1047734129 8:127750968-127750990 GAGCAAGGGTAGAGATCCAAGGG - Intergenic
1050308779 9:4332090-4332112 GTGATGGGATGGGAATCCAAAGG - Intronic
1051667549 9:19479774-19479796 CTGAAGGGATGAAAATCCAAAGG + Intergenic
1055130253 9:72766636-72766658 ATGGAGGGATGGATACCCAAAGG + Intronic
1059222684 9:112639778-112639800 GTGTATTGATGGAGATGCAATGG - Intronic
1059399078 9:114057536-114057558 GGGCAGGGCTGGTGCTCCAATGG - Intergenic
1059696841 9:116737764-116737786 GTACAGGAATGGAAAACCAAAGG + Intronic
1060768685 9:126314537-126314559 CTGCAGGGATGGGGACTCAAGGG - Intergenic
1061036902 9:128119045-128119067 GTGCAGGGATGGAGAGATAGAGG + Intergenic
1061478245 9:130883565-130883587 GTGCAGGGATGAAGAGGCCAGGG - Intronic
1062376631 9:136264655-136264677 GGGCAGGGATGGGGATCCCGGGG + Intergenic
1186154593 X:6712074-6712096 GTGCAGGGCTAGGGAACCAAAGG + Intergenic
1186898935 X:14032822-14032844 GGGCAGGGAGGGACATCCAGTGG - Intergenic
1194281823 X:91962712-91962734 TTGCAGGGATGGAGTTCTCATGG - Intronic
1194905954 X:99576507-99576529 GTGCAGGGATGGAGCCCGTATGG + Intergenic
1199072568 X:143496232-143496254 GTGTAGGGTTTGAGATCCAAAGG + Intergenic
1200599419 Y:5187366-5187388 TTGCAGGGATGGAGTTCTCATGG - Intronic
1200920328 Y:8607380-8607402 GTGCAGGAATGGAGTTCCATGGG - Intergenic
1201149041 Y:11085353-11085375 GTGCAGGCATGGAGATTCTGGGG + Intergenic