ID: 1062776085

View in Genome Browser
Species Human (GRCh38)
Location 10:149231-149253
Sequence CCCAGGCCACAGTGCAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1348
Summary {0: 1, 1: 3, 2: 9, 3: 145, 4: 1190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062776085_1062776091 3 Left 1062776085 10:149231-149253 CCATCCCTGCACTGTGGCCTGGG 0: 1
1: 3
2: 9
3: 145
4: 1190
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data
1062776085_1062776092 6 Left 1062776085 10:149231-149253 CCATCCCTGCACTGTGGCCTGGG 0: 1
1: 3
2: 9
3: 145
4: 1190
Right 1062776092 10:149260-149282 TGTGAGGCAGAACACTGAGGTGG No data
1062776085_1062776089 -10 Left 1062776085 10:149231-149253 CCATCCCTGCACTGTGGCCTGGG 0: 1
1: 3
2: 9
3: 145
4: 1190
Right 1062776089 10:149244-149266 GTGGCCTGGGAATTGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062776085 Original CRISPR CCCAGGCCACAGTGCAGGGA TGG (reversed) Intronic
900127542 1:1075272-1075294 CCCAGGCCTCATGGCGGGGATGG - Intergenic
900149548 1:1172089-1172111 CCAAAGCCACAGGGCAGGCAGGG + Intergenic
900150923 1:1179118-1179140 CCGAGGCCCCAGTGCTTGGATGG - Intronic
900252544 1:1678599-1678621 CCCAGGCCTCAGTGAGGAGAAGG + Intronic
900477806 1:2884038-2884060 TCCAGGCCTTAGTGCTGGGATGG + Intergenic
900684352 1:3938508-3938530 TCCAGGCTGCGGTGCAGGGATGG - Intergenic
900921691 1:5676171-5676193 TCTAGGCCACAGCTCAGGGAGGG - Intergenic
901004827 1:6166577-6166599 CCAAGGACACAGTCCAGGGCGGG + Intronic
901190608 1:7407771-7407793 CCCAGGCCAAGGTCCAGGCATGG + Intronic
901319205 1:8329573-8329595 CCCTGGCCACAGAGCATGGCAGG - Intronic
901814674 1:11787433-11787455 CCCAGGCTGCACTGCAGTGATGG - Exonic
901887389 1:12231950-12231972 CCCAGGCTGGAGTGCAGTGACGG - Intronic
901887974 1:12237448-12237470 CCCAGGCCAGAGTGCAGTGGAGG - Intronic
902266804 1:15272877-15272899 CCCAGGTCACAGAGCTAGGAAGG - Intronic
902510627 1:16965264-16965286 CCCAGGGCCCAGTGCAAGGGTGG - Intronic
902569369 1:17337194-17337216 CCCAGGCTGGAGTGCAGGGGCGG + Intronic
902599511 1:17531579-17531601 TCCAGGCAACCCTGCAGGGAAGG - Intergenic
902750018 1:18501583-18501605 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
902757118 1:18556230-18556252 CCCAGGCTGCTGTGCAGGGCTGG - Intergenic
902772941 1:18656455-18656477 CCCAGGCTGCAGTGCAGTGGCGG - Intronic
903072661 1:20734586-20734608 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
903172170 1:21561080-21561102 CCCACTCCCCACTGCAGGGATGG + Exonic
903198026 1:21708118-21708140 CCCAGGCCAGAGTGCAATGGTGG - Intronic
903261316 1:22133196-22133218 CACAGGGCACAGTGCATAGAAGG + Intronic
904001891 1:27343374-27343396 TCCAGGCAACAGGGCAGGGCTGG + Intronic
904032992 1:27544755-27544777 CCCAGGCCAAGGTGGTGGGACGG - Intronic
904179627 1:28657041-28657063 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
904216339 1:28923153-28923175 CCCAGGCTGGAGTGCAGTGATGG + Intronic
904470612 1:30733794-30733816 CCCCAGCCCCAGTGCTGGGAGGG - Exonic
904498411 1:30900645-30900667 CCCAAGCCCCAGCCCAGGGAGGG + Intronic
904522317 1:31105233-31105255 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
904631756 1:31848027-31848049 CCCAGGCCGGAGTGCAGTGGTGG - Intergenic
904730079 1:32583784-32583806 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
904815852 1:33197641-33197663 TCCAGGCCACAGTACGGGGGAGG + Intergenic
905075712 1:35268957-35268979 CCCCGCCCACACTGCAGGCACGG - Exonic
905082457 1:35336427-35336449 CCCAGGCTCCAGTGCAGTGGTGG + Intronic
905125076 1:35710441-35710463 CCCAGGCTTCAGTGCAGTGGTGG + Intergenic
905187778 1:36209017-36209039 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
905239074 1:36570934-36570956 TCCAGGCCACAGTCAGGGGAGGG - Intergenic
905373079 1:37497278-37497300 CCCAGGCTGGAGTGCAGGGGCGG + Intronic
906066902 1:42987371-42987393 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
906299634 1:44672725-44672747 CCCAGGCCGGAGTGCAGTGGCGG - Intronic
906438736 1:45821561-45821583 CCCAGGCTGAAGTGCAGGGCAGG + Intronic
907457577 1:54585348-54585370 CCCAGGCCTGGGGGCAGGGAAGG + Intronic
907489331 1:54799164-54799186 CCCAGGACACAGCACAGGGTTGG + Intronic
907879970 1:58539797-58539819 TCCAGGCCACAATGCAGACAGGG + Intronic
907893966 1:58666012-58666034 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
907935799 1:59041138-59041160 CCCAGGCTAGAGTGCAGTAATGG - Intergenic
907963526 1:59306710-59306732 CCCAGGACAGATAGCAGGGAGGG + Intronic
908263836 1:62359789-62359811 CCCAGGCTGCAGTGCAGGGGTGG - Intergenic
908576024 1:65461016-65461038 CCCAGGCCAGAGTGCAATGGTGG + Intronic
908594337 1:65670277-65670299 CCCAGGCTGCAGTGCAGTGGTGG - Intergenic
908775738 1:67638289-67638311 GCCAGGCCACAGAGCAGCCATGG + Intergenic
908815060 1:68023282-68023304 CCCAGGGCACAGAGCTAGGAAGG - Intergenic
909016735 1:70388146-70388168 TCCAGACCACAGTGCAGGAAAGG - Intergenic
909614965 1:77597408-77597430 CACAGGCCACACTGAAGGAATGG - Intronic
909678871 1:78268868-78268890 CACAGGCAACAGTGAGGGGAGGG - Intergenic
910334678 1:86113791-86113813 CCCAGGCTGGAGTGCAGTGATGG - Intronic
910504665 1:87936189-87936211 TCCAGGCTACAGAGCAAGGAAGG - Intergenic
910577561 1:88783345-88783367 TCTAGGACACAGTGCAGGGAGGG - Intronic
911334890 1:96571114-96571136 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
911482510 1:98461740-98461762 CCTAGGCCACAGAGCAGAGTAGG - Intergenic
911731281 1:101294686-101294708 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
911889075 1:103344325-103344347 CCCAGGCCTAAGTGCAGTGATGG + Intergenic
911923671 1:103798816-103798838 CCCAGGCTGGAGTGCAGTGAGGG - Intergenic
912100799 1:106201705-106201727 GCCAGGGCACAGTGCAGCAATGG + Intergenic
912340170 1:108906839-108906861 CCCAGGCTGGAGTGCAGTGACGG + Intronic
912451056 1:109768122-109768144 CCCAGGCCAGGGTGGTGGGAGGG - Intronic
912696772 1:111847987-111848009 CTCAGGCCACTGTGCAGTCAAGG + Intronic
913150863 1:116041585-116041607 GCCAAACCACAGTGCAGGGAAGG + Intronic
913347342 1:117821394-117821416 TGCAGGACACAGTGCAGGTAAGG - Intergenic
913672998 1:121115771-121115793 CCCAGGCCGGAGTGCAGTGGCGG - Intergenic
913961837 1:143344941-143344963 CCCACGCCACCGTGCATGGCTGG + Intergenic
914056192 1:144170515-144170537 CCCACGCCACCGTGCATGGCTGG + Intergenic
914122954 1:144795847-144795869 CCCACGCCACCGTGCATGGCTGG - Intergenic
914344093 1:146783367-146783389 CCCAGGCTACAGTGCAGTGGTGG + Intergenic
914409604 1:147413634-147413656 TCCAGGCCACAGCACAAGGAGGG - Intergenic
914899409 1:151703862-151703884 CCCAGGTCACGGCTCAGGGATGG + Intronic
915549691 1:156624948-156624970 TCGAGGCAAAAGTGCAGGGAGGG - Intronic
916032002 1:160885112-160885134 TCCAGGGCGCAGTGGAGGGAGGG - Exonic
916174417 1:162025542-162025564 CCCAGGCTATAGTGCAGTGGCGG - Intergenic
916241205 1:162641991-162642013 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
916881027 1:169019571-169019593 CCCAGGTCACAGGGAAGGTAGGG + Intergenic
916922984 1:169487986-169488008 CCCAAGCCTCAGGGAAGGGATGG - Intergenic
917318126 1:173750344-173750366 CTCAGGCCAGAGTGCTGTGATGG + Intronic
917519907 1:175739604-175739626 CCCAGCCCACAACCCAGGGACGG + Intronic
917584173 1:176408603-176408625 TCCAGGCCATAGTGCAGGTTGGG - Intergenic
917711068 1:177685789-177685811 TCCAGGCCACGGCACAGGGAGGG - Intergenic
918091628 1:181300144-181300166 CTAAGGGAACAGTGCAGGGATGG + Intergenic
919065538 1:192688691-192688713 TGCAGCCCACAGAGCAGGGAGGG - Intergenic
919320248 1:196027394-196027416 CCCAGGGCAAAGGGCAGTGACGG + Intergenic
919703986 1:200658651-200658673 CCCAGGCTGGAGTGCAGTGACGG - Intronic
919766019 1:201127767-201127789 CCAGGGACACAGTGCAGGGCTGG + Intergenic
919774264 1:201183939-201183961 GCCAAGCCACTGGGCAGGGATGG + Intergenic
919880090 1:201895424-201895446 CCTAGGTCCCAGTGCTGGGAAGG + Intergenic
919918260 1:202152511-202152533 CACAGGCTGCAGTGAAGGGAGGG + Intronic
920038327 1:203080131-203080153 CCCTGGACACAGCCCAGGGAGGG + Intergenic
920339190 1:205265091-205265113 TCCAGGCCTCTGTGGAGGGACGG + Intronic
920394720 1:205636220-205636242 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
920545054 1:206809492-206809514 CCCAGCCCACAGTTCTGGTAGGG + Intronic
920553176 1:206882213-206882235 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
920575997 1:207060841-207060863 CCCAGGCTGGAGTGCAGTGACGG + Intronic
921084846 1:211779808-211779830 CCCAGGCTGGAGTGCAGTGATGG - Intronic
921191416 1:212712127-212712149 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
921784673 1:219215705-219215727 CCCAGTCCACAGTACAGGGAGGG - Intergenic
922181828 1:223241903-223241925 CCCAGGCCACCGTAAAGGGGAGG - Intronic
922272337 1:224045096-224045118 CCCAGGCTAGAGTGCAGTGGCGG - Intergenic
922287497 1:224183106-224183128 CCCAGGCCCCCGTGCGGGGCCGG - Intronic
922460809 1:225813222-225813244 CCCTGGCCACAGGGTAGGGGAGG + Intronic
922768527 1:228169014-228169036 CCCATGCCACATAGCTGGGAGGG - Intronic
923161870 1:231321681-231321703 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
923502299 1:234575840-234575862 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
923675542 1:236077755-236077777 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
923682291 1:236128011-236128033 CCCAGGCTGCAGTGCAGTGGCGG + Intergenic
924019115 1:239761955-239761977 TCCAGGCTGCAGTGCAGGGAAGG - Intronic
924030552 1:239881238-239881260 CCCAGGCTGGAGTGCAGGGGCGG - Intronic
924056231 1:240127072-240127094 CTCAGGCCACAGCACAGGCAGGG + Intronic
924234312 1:241987841-241987863 CCCAGGCTGCAGTGCAGTGGTGG - Intergenic
924716905 1:246583982-246584004 CCCAGGCTGGAGTGAAGGGATGG + Intronic
924721119 1:246624018-246624040 CCCAGGCTGGAGTGCAGTGATGG - Intronic
924904648 1:248439346-248439368 ACCATGCCACAGTGGATGGATGG - Intergenic
924923240 1:248652702-248652724 ACCATGCCACAGTGGATGGATGG + Intergenic
1062776085 10:149231-149253 CCCAGGCCACAGTGCAGGGATGG - Intronic
1063718100 10:8549624-8549646 TGCAGGCCACAGTGGAGGGAAGG - Intergenic
1063965667 10:11344211-11344233 CCCAGGACACGGGGCAGGGCTGG + Intergenic
1064084574 10:12335689-12335711 CCCATGCTAGAGTGCAGTGATGG - Intergenic
1064166443 10:12990215-12990237 CCCAGGCCAGAGTGCAGTAGTGG - Intronic
1064626801 10:17269674-17269696 CCCAGGCTGGAGTGCAGAGATGG - Intergenic
1064629282 10:17293241-17293263 CCCAGGCTGGAGTGCAGGGGCGG + Intergenic
1064806081 10:19135195-19135217 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1065131257 10:22622459-22622481 CCCAGGCCTCAGAGCACAGATGG - Intronic
1065270445 10:24027241-24027263 TCCAGGTCATAGTGCAGGGAGGG - Intronic
1065728638 10:28691046-28691068 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1065749094 10:28869172-28869194 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1065945614 10:30603477-30603499 CCCAGGCTGCAGTGCAGTGGTGG + Intergenic
1066138344 10:32475249-32475271 GCCAGTCCACAGTGTAGGGAAGG - Intronic
1066377480 10:34870438-34870460 CCCAAGCTAGAGTGCAGTGATGG - Intergenic
1066538170 10:36413817-36413839 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1066546264 10:36503814-36503836 CCCAGGCTATAGTGCAGTGGTGG + Intergenic
1067413370 10:46084575-46084597 CCCAGGGCACAGAGCAGGGTGGG + Intergenic
1067685059 10:48461776-48461798 CACAAGCCACCCTGCAGGGAAGG - Intronic
1068481320 10:57591664-57591686 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1068483847 10:57630680-57630702 CCCAGGCCGGAGTGCAGTGGTGG - Intergenic
1069049200 10:63774933-63774955 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1069448981 10:68500886-68500908 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1069655783 10:70087138-70087160 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1069869912 10:71526839-71526861 CCCACGTCACAGAGCAGAGATGG + Intronic
1070251307 10:74775935-74775957 CCCAGGCCCTAGTGCAGTGACGG - Intergenic
1070256853 10:74820478-74820500 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1070436888 10:76402393-76402415 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1070506957 10:77122113-77122135 CCTAGGGCACAGTGGTGGGAAGG + Intronic
1070799704 10:79238066-79238088 CCCAGGCTACCGAGCGGGGAGGG - Intronic
1071582433 10:86785346-86785368 CCCAGGCTGCAGTGCAGTGGTGG + Intronic
1072220618 10:93324820-93324842 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1072649717 10:97285373-97285395 CCCAGGCCAGAGTGTAGTGGCGG + Intronic
1072682424 10:97516878-97516900 CCAAAGCCAGGGTGCAGGGAGGG + Intronic
1073126601 10:101154507-101154529 CCCAGGCTGAAGTGCAGTGATGG + Intergenic
1073160719 10:101392537-101392559 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1073299853 10:102464406-102464428 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1073300920 10:102470577-102470599 CCCAGGCCCCAGGGGAGGGATGG - Intronic
1073469441 10:103713791-103713813 CCCAGGCCACACAGCAGGTGGGG + Intronic
1074314056 10:112346001-112346023 GTCAGACCACAGTGCAGGGTAGG - Intergenic
1074806826 10:117062084-117062106 ATCAGGCCACAGTGACGGGAAGG - Intronic
1074878426 10:117632452-117632474 CCAAGGCGACTGTGCAGGGAAGG - Intergenic
1075215570 10:120529907-120529929 CCCAGGCTGGAGTGCAGAGATGG - Intronic
1075260892 10:120963176-120963198 CCATGGAGACAGTGCAGGGATGG - Intergenic
1075348122 10:121699302-121699324 CCCAGGCCACACTGGGAGGAAGG + Intergenic
1075385770 10:122054289-122054311 CCCAGGGGCCTGTGCAGGGATGG - Intronic
1075907642 10:126095489-126095511 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1076053037 10:127350382-127350404 CCAAGGCCCCATGGCAGGGAGGG - Intronic
1076191090 10:128483913-128483935 CCCAGGCCACTCAGCTGGGAAGG - Intergenic
1076574323 10:131453787-131453809 CCCGGGGCACAGGGCAGGGGCGG - Intergenic
1076719210 10:132385864-132385886 CACTGGCCAGAGAGCAGGGAGGG - Intergenic
1076904631 10:133355880-133355902 CCCAGGGCCCAAAGCAGGGAGGG + Intronic
1076911403 10:133392016-133392038 CCCCGGCCTCAGGGCAGGGCAGG - Intronic
1077131796 11:976658-976680 CCCAGCCCACTGTTCAGGGTGGG + Intronic
1077201008 11:1307568-1307590 CCCAGACCACACAGCAAGGAAGG + Intronic
1077248299 11:1549601-1549623 CGCAGGGCACAGGGCAGGGCGGG - Intergenic
1077354453 11:2108785-2108807 CCCCAGCCACAGGGCAGGAAGGG + Intergenic
1077442204 11:2574117-2574139 TGGAGGCCAGAGTGCAGGGAGGG + Intronic
1077511117 11:2963660-2963682 CCCAGGCCCCAGTGCTGAGATGG + Intronic
1078103890 11:8346371-8346393 CCCAGGGTACAGGGCAGGGTGGG + Intergenic
1078183399 11:9030862-9030884 CCCAGGGCACAGAGCTGGCAAGG + Exonic
1078213912 11:9295575-9295597 CCCAGGCTGCAGTGCAGTGGTGG + Intronic
1078272130 11:9805663-9805685 CCCAGGCTGCAGTGCAGTGGGGG + Intronic
1078500657 11:11871814-11871836 TCTAGGCTGCAGTGCAGGGAGGG - Intronic
1078873685 11:15372834-15372856 CCCAGGCTAGAGTGCAGTGGAGG + Intergenic
1079093321 11:17495431-17495453 CCCAGGCAGCACTTCAGGGATGG + Intronic
1079356184 11:19731939-19731961 TACAAGCCACAGAGCAGGGATGG - Intronic
1079418480 11:20263229-20263251 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1079818527 11:25094421-25094443 CCCCGGCCTCTGTGCTGGGATGG + Intergenic
1079875328 11:25849000-25849022 CACAGGCCACAGGGAAGGGAGGG - Intergenic
1080090074 11:28337304-28337326 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1080417924 11:32086914-32086936 GCCAGGTCACTGTGCAGAGAGGG - Intronic
1080527839 11:33144932-33144954 CCCAGGCCCGAGTGCAGTGGCGG - Intronic
1080587508 11:33695100-33695122 GCCAGGCCAGAGGGCAGTGAAGG - Intergenic
1080688212 11:34533430-34533452 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1080859550 11:36141495-36141517 CCCAGACCTCAGGACAGGGATGG - Intronic
1080878848 11:36300858-36300880 CCCAGGGCACAGGCCTGGGATGG + Intronic
1081233906 11:40621931-40621953 CCCAGGCCACACAACTGGGATGG + Intronic
1081537447 11:44005950-44005972 CAAAGGCCAAAGTGCAGGGGAGG + Intergenic
1081823362 11:46022410-46022432 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1082012278 11:47458302-47458324 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
1082215018 11:49558780-49558802 CCCCTCCCCCAGTGCAGGGATGG + Intergenic
1083159291 11:60844781-60844803 CCCAGAGCCCAGTGCAGGGTAGG + Intronic
1083304782 11:61756596-61756618 CCCAGCACCCAGTGCAGGGCAGG + Intronic
1083555556 11:63623471-63623493 CCCAGGCTGCAGTACAGTGATGG + Intergenic
1083628559 11:64084424-64084446 GCCTGCCCACAGTGCAGGGAGGG - Intronic
1083660224 11:64248661-64248683 CACAGGGCTCAGTTCAGGGAAGG + Intergenic
1083793479 11:65000992-65001014 CCCAGGCTAAAGTGCAGTGGTGG + Intergenic
1083871922 11:65493711-65493733 CCCAGGCTAGAGTGCAGTGACGG - Intergenic
1083977188 11:66132709-66132731 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1084072766 11:66746834-66746856 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1084196071 11:67524109-67524131 CCCAGGACTTAGTCCAGGGAGGG - Intergenic
1084206756 11:67599103-67599125 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1084220016 11:67672188-67672210 CCCAGGCCAGAGTGCAGTGGTGG + Intronic
1084301185 11:68253734-68253756 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1084416668 11:69036476-69036498 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1084569172 11:69949265-69949287 CCCAGGGCACAGGGCTGGGGAGG + Intergenic
1084642228 11:70432799-70432821 CCCAGGCAACAGTGTGGGCAGGG + Intronic
1084754227 11:71224601-71224623 CCCTGGCCACAGTGCAAAGGTGG + Intronic
1084796680 11:71510875-71510897 CCAAGGCAGCAGTGAAGGGATGG - Intronic
1084893128 11:72246462-72246484 CCCAGGCTGCAGTGCAGAGGTGG + Intergenic
1085136132 11:74090360-74090382 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
1085200282 11:74697719-74697741 ACCTGTCCCCAGTGCAGGGAGGG + Intronic
1085204190 11:74720756-74720778 CCCAGCCCCCAGTGCTGAGAGGG - Intronic
1085265571 11:75236104-75236126 CCCAGGCCACAGAGCGGAGGAGG + Intergenic
1085286070 11:75362034-75362056 CCCAGGCTAGAGTGCAGTGTTGG - Intergenic
1085305030 11:75481117-75481139 CACTGACCAAAGTGCAGGGAGGG + Intronic
1085476938 11:76794852-76794874 TGCAGGCCCCATTGCAGGGAGGG + Intronic
1085680122 11:78565477-78565499 TTCAGGCCACAGCACAGGGAAGG + Intronic
1085767356 11:79294804-79294826 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1085888756 11:80552557-80552579 ACCAGGCCAGAGTGCAGTGGTGG + Intergenic
1086308734 11:85511759-85511781 CCCAGGCTAAAGTGCAGTGGTGG + Intronic
1086328402 11:85728327-85728349 CCTAGGCCAGAGTGCAGTGGCGG + Intronic
1086634561 11:89065689-89065711 CCCCTCCCCCAGTGCAGGGATGG - Intronic
1087327253 11:96738861-96738883 CCCAGGCCACAGGGGAGTGGTGG + Intergenic
1087380878 11:97403435-97403457 CCCAGGCTGCAGTGCAGTGGTGG + Intergenic
1088051110 11:105516549-105516571 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1088267112 11:107998291-107998313 CCCAGGCCAGAGTGCAGTTGGGG - Intergenic
1088704084 11:112445801-112445823 TCCAGGCCACAGAGCAGAGAAGG - Intergenic
1088774253 11:113066959-113066981 CCCAGGCCGGAGTGCAGTGGCGG - Intronic
1088803482 11:113329396-113329418 TCCAGGGCACAAAGCAGGGAAGG - Intronic
1088934752 11:114388628-114388650 CCCAGGCTAGAGTGCAGGGGTGG + Intergenic
1089171213 11:116512894-116512916 CACAGGCCACATTCCAGGCAGGG + Intergenic
1089353296 11:117833618-117833640 TCCAGGCCACAGAGAAGGAATGG - Intronic
1089591742 11:119546329-119546351 CCCAGGCCAGAGTTCAGGGCAGG - Intergenic
1089613253 11:119681316-119681338 CCCAGGTGAGAGCGCAGGGAAGG + Intronic
1089861920 11:121597498-121597520 CCCAGGCTGGAGTGCAGGGGCGG + Intronic
1090027878 11:123183271-123183293 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1090345579 11:126066750-126066772 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1090420784 11:126573471-126573493 CCCAGCCCACACAGCAAGGAGGG + Intronic
1090707218 11:129349449-129349471 CCCAGGCCAGAGTGAAGTGGTGG + Intergenic
1090796779 11:130142098-130142120 CCCAGCCCACAGTGCAGAGCAGG - Intronic
1090805012 11:130197509-130197531 CCCAGCACACAGGGCAGGGCAGG + Intronic
1090901777 11:131038343-131038365 CCCAGGCCGGAGTGCAGTGGTGG + Intergenic
1090920882 11:131204928-131204950 CTCGGGCCACAGTACAGCGAAGG + Intergenic
1091157128 11:133384320-133384342 ACCAGGCCAGAGTGGAGGGTGGG - Intronic
1091251265 11:134146185-134146207 CCCACTGCACAGTGAAGGGAAGG + Intronic
1091727731 12:2857296-2857318 CCCAGGCCTCAGGGTGGGGATGG + Intronic
1092175436 12:6402070-6402092 CCCAGGCTGGAGTGCAGGGTGGG - Intergenic
1092262689 12:6960973-6960995 CCAAGGACACAGGGCAGGGCAGG - Intronic
1092735908 12:11582580-11582602 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1092768105 12:11871229-11871251 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1093733560 12:22593096-22593118 CCCAGGCCGGAGTGCAGTGGGGG + Intergenic
1093853912 12:24075224-24075246 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1094460368 12:30691394-30691416 CCCAGGCCACAGGGCAGAGCAGG - Intronic
1095004875 12:36797511-36797533 CCCAGGCTGGAGTGCAGGGGTGG + Intergenic
1095165047 12:38962319-38962341 CCCAGGCCGTTGTGCAGAGAGGG - Intergenic
1095433003 12:42154469-42154491 CCCAGGCTGGAGTGCAGGGGTGG + Intergenic
1095506255 12:42902248-42902270 TCCAGGCTGCAGGGCAGGGAAGG - Intergenic
1096009287 12:48199146-48199168 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1096310393 12:50515522-50515544 ACCAGTCCACAGTGTAGGGCTGG - Intronic
1096459396 12:51814096-51814118 CGCTCGCCACAGTGCAGGGCTGG - Intergenic
1096484165 12:51966489-51966511 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1096716670 12:53495497-53495519 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
1097072063 12:56362334-56362356 CCCAGACTAGAGTGCAGTGATGG + Intronic
1097184136 12:57187574-57187596 CCCAGATCACACAGCAGGGAAGG - Intronic
1097334935 12:58371617-58371639 CCCACCCCAAGGTGCAGGGAAGG + Intergenic
1098042728 12:66368570-66368592 CCCAAGCCACAGTGCACAGCTGG - Intronic
1098391393 12:69973236-69973258 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1098913046 12:76229756-76229778 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1099185980 12:79515800-79515822 TCCAGGACACAGCACAGGGAGGG - Intergenic
1099761406 12:86924475-86924497 CCCTTACCACAGTGCAGGGGAGG + Intergenic
1100018738 12:90044621-90044643 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1100409336 12:94299600-94299622 CCCAGGCTGCAGTGCAGTGGTGG + Intronic
1100458240 12:94773616-94773638 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1100494389 12:95111023-95111045 CCCAGGCTACAGTGCAGTCGCGG + Intronic
1100575985 12:95891980-95892002 TCCAGGATGCAGTGCAGGGATGG - Intronic
1100947741 12:99805589-99805611 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1100983403 12:100182151-100182173 TCCAGGCCAGGGTGCAGGCAAGG + Intergenic
1101149241 12:101869227-101869249 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1101602109 12:106219220-106219242 CCCAGGCTGTGGTGCAGGGAGGG - Intergenic
1101712880 12:107284857-107284879 CAAAAGCCACAGTGCATGGATGG + Intergenic
1102030921 12:109739685-109739707 CCCAGTCAACTGGGCAGGGAGGG - Intronic
1102086196 12:110142202-110142224 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1102247204 12:111362958-111362980 GCCAGGGCAGAGGGCAGGGACGG + Exonic
1102378211 12:112441004-112441026 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1102505060 12:113379263-113379285 CCCAGGCTAGAGTGCAGTGGGGG - Intronic
1102536113 12:113582806-113582828 CCCAGGTCACAGCTGAGGGAGGG - Intergenic
1102760987 12:115384821-115384843 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1102896355 12:116601468-116601490 CCCAGGCACCCGTTCAGGGAAGG - Intergenic
1102923821 12:116811901-116811923 CCCAGGACCCAGTCCAGGGCTGG - Intronic
1103165305 12:118765268-118765290 CCCAGGCCAAAGGGCAGAGTTGG - Intergenic
1103619029 12:122174660-122174682 CCCACGCCGGTGTGCAGGGACGG + Intronic
1104029506 12:125054183-125054205 CCAAAGCAACAGTGCAGAGACGG - Intergenic
1104695849 12:130862978-130863000 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1104781492 12:131423254-131423276 TACAGGCAACAGAGCAGGGAAGG + Intergenic
1105025323 12:132844671-132844693 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1105228661 13:18465385-18465407 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1105342497 13:19540342-19540364 CCCAGGCTGCAGTGCAGTGGCGG + Intergenic
1105464720 13:20627686-20627708 CTCAGGCCAGAGTGCAGTGGTGG - Intronic
1105807583 13:23964945-23964967 CCCAGGCTGAAGTGCAGAGATGG - Intergenic
1106060816 13:26289591-26289613 CCCAGGCTGCAGTGCAGTGGCGG + Intronic
1106122558 13:26872783-26872805 CCCAGGCCACAGATCAAAGAGGG - Intergenic
1106415691 13:29543983-29544005 CAGAGGCCCCAGTGCAGGCATGG + Intronic
1106709511 13:32315259-32315281 CCCAGGCCACCCTGCTTGGAGGG - Intronic
1107188613 13:37552073-37552095 CCTAGGCTGCAGTGCAGGAATGG + Intergenic
1107563949 13:41583145-41583167 CCCAGGCCAATGCGCAGGGCAGG - Intronic
1108484239 13:50908921-50908943 CCCAGGCCAGAGTGCAGTGGTGG + Intergenic
1108486018 13:50925916-50925938 TCCAGGCCACAGTGCAGAAAGGG - Intronic
1108642395 13:52395041-52395063 CCTGGGCCCCAGTGCAGAGATGG + Intronic
1109276738 13:60311902-60311924 CCCATGGCACAGAGCAGAGAAGG + Intergenic
1110856384 13:80301580-80301602 CCCAGGCCGCAGTGCCGTGGCGG + Intergenic
1111540528 13:89661965-89661987 CCCAGCCCCAAGTGGAGGGAGGG - Intergenic
1111984734 13:95054503-95054525 CCCAGGCTGGAGTGCAGTGACGG - Intronic
1112098769 13:96164512-96164534 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1112273712 13:97995710-97995732 CCCAGGCTGCAGTGCAGTGGCGG - Intronic
1112323980 13:98431311-98431333 CCCATGCCACAGTTCAGGCCGGG + Intronic
1112432204 13:99359856-99359878 TGCAGGCCACCATGCAGGGAAGG - Intronic
1112610764 13:100952626-100952648 CCCAGGACAAAGAGCAGTGAAGG + Intergenic
1113498245 13:110750902-110750924 CCCAGGACACAGAGCATGGAAGG + Intergenic
1113587518 13:111475450-111475472 CCCAGGAGACAGGGGAGGGATGG + Intergenic
1113589774 13:111490156-111490178 CCCAGGCTGGAGTGCAGGGGAGG - Intergenic
1113848871 13:113406953-113406975 CCCAGGCGAGTGTGCAGGGGAGG - Intergenic
1113871656 13:113563621-113563643 CCCAGGCCCCAGGACAAGGATGG + Intergenic
1113930905 13:113968370-113968392 CCCAGGCCACCGTCCCGGGCAGG + Intergenic
1114008187 14:18335236-18335258 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1114012941 14:18392259-18392281 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1114277668 14:21162230-21162252 TCCAGACCACAGGGCAGAGAAGG + Intergenic
1114405115 14:22449245-22449267 TCCAGGCCCCAAAGCAGGGAGGG - Intergenic
1114939576 14:27591624-27591646 TCCAGTCCATGGTGCAGGGAGGG - Intergenic
1115197157 14:30813454-30813476 TTCAGGGCACAGTGCCGGGAGGG + Intergenic
1115923181 14:38400953-38400975 TCCAGGGGACAGAGCAGGGAGGG + Intergenic
1115987640 14:39118823-39118845 CCCAGGCTAGAGTGCAGTCATGG + Intronic
1116113852 14:40622888-40622910 CCCAGGCTATAGTGTAGTGATGG - Intergenic
1117097807 14:52315254-52315276 CCCCGGCCACTGCCCAGGGAAGG - Exonic
1117285931 14:54285791-54285813 CCAACCCCACAGTGCAGAGATGG - Intergenic
1117340534 14:54788010-54788032 CCCAGGCTACAGAGAAGGCAGGG - Intronic
1118421694 14:65612672-65612694 TCCAGACCACAGTGTATGGAGGG - Intronic
1119076228 14:71642252-71642274 TCCAGGCTACAGTACAGGCAGGG + Intronic
1119229474 14:72968999-72969021 CCCAGGCTACAGTGCAACAATGG + Intergenic
1119663062 14:76465263-76465285 CCCATGGCACAGCACAGGGATGG + Intronic
1119668048 14:76498836-76498858 CCCAGGCCACAGATGGGGGAGGG - Intronic
1120913964 14:89694007-89694029 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1120978833 14:90273513-90273535 CCCAGGCTGGAGTGCAGTGACGG - Exonic
1121290106 14:92767427-92767449 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1121393830 14:93600155-93600177 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1121573003 14:94961736-94961758 CCCAGGCCACAGCTGATGGAAGG - Intergenic
1121817895 14:96942529-96942551 GGGAGGCCACAGTGCAGGAAGGG - Intergenic
1121928339 14:97949149-97949171 CCCAGGAACCAGAGCAGGGAGGG - Intronic
1122390885 14:101382645-101382667 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1122407485 14:101509011-101509033 CCCAGGCCAAGGTGGAGGGCTGG - Intergenic
1122617595 14:103030651-103030673 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1122626519 14:103087954-103087976 CCCAGTCCCCAGGGCAGGGATGG - Intergenic
1122631959 14:103111365-103111387 GACTGTCCACAGTGCAGGGAGGG - Intergenic
1122874272 14:104656331-104656353 CTCAGGCCCCAGCGGAGGGAGGG + Intergenic
1122977765 14:105177960-105177982 ACCAGGGCAAAGGGCAGGGAAGG + Intronic
1123122899 14:105926361-105926383 CCCAGGCCCCAGTCCAGCAAGGG - Intronic
1123192026 14:106580512-106580534 CACAGGGCACACTGCAGGGCTGG + Intergenic
1123220766 14:106853192-106853214 CACAGGGCACACTGCAGGGCTGG + Intergenic
1123465940 15:20515709-20515731 CCCAGGCTAGAGTGCAGTGGCGG - Intergenic
1123652174 15:22485330-22485352 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1124114323 15:26827209-26827231 CCCAGGAGACAGGGCAGAGAAGG - Intronic
1124253295 15:28121716-28121738 CACAGGGCACAGAACAGGGAGGG + Intronic
1124269076 15:28264490-28264512 CCAAGGCCAGACTGCAGGGTAGG + Intronic
1124276663 15:28331683-28331705 CCCAGGCTAGAGTGCAGTGGCGG - Intergenic
1124306037 15:28579924-28579946 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1124566685 15:30822111-30822133 CCCAGGTCTCAGTAGAGGGAGGG - Intergenic
1124572515 15:30877916-30877938 CCCAAGCTACGGTGCAGGCAAGG - Intergenic
1125251574 15:37711257-37711279 CCTATCCCACATTGCAGGGAAGG + Intergenic
1125707046 15:41747651-41747673 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1125727043 15:41873454-41873476 CCCAGACCACACTGCAGGGGAGG + Intronic
1125734115 15:41911772-41911794 GCTAGGCCCCAGAGCAGGGAAGG - Intronic
1125734139 15:41911870-41911892 GCCAGGCCCCAGCTCAGGGAGGG + Intronic
1126118714 15:45232072-45232094 CTCAGGCCAGAGTGCAGCGGTGG - Intergenic
1126175272 15:45730129-45730151 CCCAGGCAACAGAGCATTGACGG + Intergenic
1126313668 15:47344493-47344515 TCCAGGCCACTATGCAGGGAGGG + Intronic
1126650467 15:50915968-50915990 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1127389665 15:58495188-58495210 CCCAGCCCACACTGCAGTCAAGG - Intronic
1127618537 15:60710805-60710827 CCCAGGGCACAGAAGAGGGAGGG + Intronic
1127640971 15:60915397-60915419 CACAGGCCCCAGTGCAGAGGAGG + Intronic
1127776886 15:62270638-62270660 CCGACACCACAGGGCAGGGAGGG + Intergenic
1127857396 15:62963622-62963644 TGCAGGCCACAGTGCAGTGGGGG - Intergenic
1127929355 15:63581735-63581757 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1128136956 15:65270940-65270962 GACAATCCACAGTGCAGGGAAGG - Exonic
1128137543 15:65275070-65275092 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1128182023 15:65612491-65612513 CCCTGGCCCCAGTGCTGGCAGGG - Intronic
1128252396 15:66172363-66172385 ACCAGGCCACGGAGCAGGCAGGG - Intronic
1128434979 15:67637777-67637799 CCCAGGCCTCAGTGCAGGGAGGG - Intronic
1128546726 15:68573471-68573493 GCCAGGCCAGAGAGCAGGGAAGG + Intergenic
1128907421 15:71480077-71480099 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1129227813 15:74180068-74180090 CCCAGCCCTGAGGGCAGGGAAGG - Exonic
1129468929 15:75739405-75739427 CCAAGGTCACAGTTCTGGGAGGG + Intergenic
1129730842 15:77931939-77931961 CCCAGGCTACAGTGGAGTGGTGG + Intergenic
1130213207 15:81945212-81945234 CCCAGGCCAAGGTGCAGAGGTGG - Intergenic
1130552028 15:84895382-84895404 CCCAGGCCATGGAGCAAGGAGGG + Intronic
1130552399 15:84898808-84898830 TCCAGACCACAGCACAGGGAAGG + Intronic
1130709630 15:86266855-86266877 CCCAGGCTGGAGTGCAGGGCGGG - Intronic
1130838620 15:87676020-87676042 TCCAGGCCACAGCACAGGGAGGG + Intergenic
1130846643 15:87753840-87753862 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
1130899583 15:88197154-88197176 CCCTGGGCACAGTACATGGAAGG + Intronic
1131492166 15:92872633-92872655 TCCAGGCCTCAGTGCTGGGAGGG - Intergenic
1131632424 15:94193366-94193388 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1131757041 15:95576040-95576062 CCCAGGACACAGTGGGAGGATGG - Intergenic
1132233774 15:100203853-100203875 CCCAGGCTGCAGTGCAGTGATGG - Intronic
1132366821 15:101263897-101263919 CCCAGGCCAGAGTGCAATGGTGG - Intergenic
1132505290 16:305098-305120 CCGAGGCCCCACGGCAGGGAAGG + Intronic
1132862241 16:2077485-2077507 CCCAGGCCACAGGGTCAGGATGG - Intronic
1132878968 16:2152908-2152930 CCTGGGCCACAGGGCAGGGCAGG + Intronic
1132942600 16:2515347-2515369 CCCAGGCCACCAGGCAGGGTGGG - Intronic
1133049395 16:3108456-3108478 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
1133193784 16:4153878-4153900 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1133220442 16:4317159-4317181 CCCAGGCCCCAGGGCAGGGCTGG - Intronic
1133791971 16:9016042-9016064 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1133811143 16:9161931-9161953 CCCAGGCTGCAGTGCAGTGGTGG + Intergenic
1134041883 16:11075349-11075371 CCAAGGTCACAGTGCTGGGCTGG - Intronic
1134251729 16:12578790-12578812 CCCAGGGCTCAGTGTAGGGCTGG - Intergenic
1134504213 16:14792011-14792033 CCCAGGACAGAGAACAGGGATGG + Intronic
1134564266 16:15237428-15237450 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1134576360 16:15336897-15336919 CCCAGGACAGAGAACAGGGATGG - Intergenic
1134643795 16:15850340-15850362 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1134726083 16:16419604-16419626 CCCAGGACAGAGAACAGGGATGG + Intergenic
1134738228 16:16519271-16519293 CCCAGGCTAGAGTGCAGTGGCGG - Intergenic
1134901066 16:17938445-17938467 CTCAGGCTAGAGTGCAGTGATGG - Intergenic
1134929271 16:18192892-18192914 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1134941350 16:18292256-18292278 CCCAGGACAGAGAACAGGGATGG - Intergenic
1135387289 16:22054136-22054158 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1135419415 16:22295556-22295578 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1135828472 16:25751870-25751892 CCCAGACCACAGTGGATGAAAGG + Intronic
1135889864 16:26347379-26347401 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1135969170 16:27059808-27059830 CCCAGGCTAGAGTGCAGTGGCGG - Intergenic
1136252946 16:29018607-29018629 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1136352818 16:29722294-29722316 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1136503841 16:30689746-30689768 CCCAGGCTATAGTGCAGTGACGG + Intergenic
1136504519 16:30694428-30694450 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1136613785 16:31383049-31383071 CCCAGGCCTCAGTGCTGGCCAGG - Intergenic
1137019945 16:35414932-35414954 CCCAGGGAACAGTGCAGGCAGGG - Intergenic
1137026987 16:35486427-35486449 CCCAGGGAACAGTGCAGGTAGGG - Intergenic
1137232161 16:46576697-46576719 TCCAGGCCTCACTACAGGGAGGG - Intergenic
1137392966 16:48096814-48096836 ACAAGGCCACAGTGAAGGTAAGG + Exonic
1137609645 16:49810034-49810056 CCCAGGCCAAAGAGTGGGGAAGG - Intronic
1137634567 16:49974537-49974559 CCCAGGCTGCAGTGCAGTGCAGG - Intergenic
1137969309 16:52968234-52968256 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1138252959 16:55519464-55519486 CCCAGGCTGGAGTGCAGTGACGG - Intronic
1138415914 16:56871236-56871258 CAAAGGCCACGGCGCAGGGATGG - Intronic
1138427992 16:56949183-56949205 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1138496360 16:57411659-57411681 CACAGGGCAGAGTGCATGGAGGG + Intronic
1138630603 16:58291522-58291544 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1139989903 16:70931966-70931988 CCCAGGCTACAGTGCAGTGGTGG - Intronic
1140112747 16:72017812-72017834 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1141464296 16:84196177-84196199 CCCAGGACACTGTCCAGGCAGGG - Exonic
1141712929 16:85710392-85710414 CCCAGGTGATAGTGAAGGGAGGG - Intronic
1141735775 16:85851598-85851620 TCCTGGCCAAAGAGCAGGGATGG - Intergenic
1141870240 16:86780355-86780377 CGCTGGCCAGAGTGCAGAGAGGG - Intergenic
1142078009 16:88131666-88131688 CCCACGTGCCAGTGCAGGGAGGG + Intergenic
1142108460 16:88318651-88318673 CCCACGGCACAGGCCAGGGAGGG - Intergenic
1142154629 16:88527479-88527501 CCCTGGCCCCAGTGCAGGGTGGG + Intronic
1142170974 16:88622643-88622665 CACAGGCCACACTGGAGGGAGGG + Intronic
1142187105 16:88699732-88699754 CCTAGGAGACAGGGCAGGGAGGG + Exonic
1142822603 17:2482866-2482888 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1143017751 17:3900056-3900078 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1143216764 17:5230896-5230918 CCCAGGCTAGAGTGCACTGATGG - Intronic
1143868773 17:9943085-9943107 GCCAGGCCCCAGGGCTGGGAGGG + Intronic
1143874185 17:9979418-9979440 CCCAGCACACAGTGCAGCGCTGG + Intronic
1143884384 17:10055114-10055136 CCCAGGCCACTGTGCCTGGCTGG - Intronic
1144017461 17:11209549-11209571 CCCATCCCACACTGCAGGGAAGG + Intergenic
1144077521 17:11732799-11732821 GCCTGGCCACAGGGCATGGAGGG - Intronic
1144518608 17:15939081-15939103 CCCAGGCCGGAGTGCAGCGGTGG + Intergenic
1145090492 17:19981920-19981942 CCCAGGCCAGACTGCAGTGGTGG + Intergenic
1145261137 17:21355503-21355525 CCAAGGTCACAGAGCAGGGAAGG + Intergenic
1145807221 17:27743302-27743324 CCCAGGCTGCAGTGCAGTGAGGG - Intergenic
1146100221 17:29973520-29973542 CCCAGGCCGGAGTGCAGTGGCGG + Intronic
1146127003 17:30237962-30237984 CCCACACCACAGTACAGGGTGGG - Intergenic
1146266874 17:31458575-31458597 CCCAGGCTCCCGTGCAGAGAAGG - Intronic
1146361116 17:32178502-32178524 CCCAGGCCGGAGTGCAGTGGTGG + Intronic
1146480222 17:33199123-33199145 ATCAGCCCACAGTGCAGGAATGG - Intronic
1146494947 17:33313283-33313305 CCCAGGGCAGAGTGCAGTGACGG - Intronic
1146657742 17:34645017-34645039 CCCTGGCCACTGAGCAGGGCTGG + Intergenic
1146746919 17:35339426-35339448 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1146768300 17:35544248-35544270 CCAAGGCCACATTACAGGGGTGG + Intergenic
1146817048 17:35950593-35950615 CCAAGGCCACAGCGCACTGATGG + Intergenic
1147056916 17:37841844-37841866 CCCAAGCCTCAGTGCATGGGAGG - Intergenic
1147249486 17:39144492-39144514 CCCAGGCAACAGGGAAGGAAGGG - Intronic
1147283590 17:39382794-39382816 CCCAGGCTAGAGTGCAGAGTAGG - Intronic
1147398871 17:40166999-40167021 CCCAGGCTAGAGTGCAGTGACGG + Intronic
1147409044 17:40235999-40236021 CCCAGGCCCGAGTGCAGTGATGG + Intronic
1147774502 17:42891067-42891089 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1148199963 17:45743702-45743724 CAGAGGTCACAGTGCAGTGAAGG - Intergenic
1148206365 17:45782835-45782857 CCCAGCTCACAGTGCCTGGAGGG - Intergenic
1148440703 17:47710402-47710424 CCCAGGACCCAGGGCAGGGAGGG - Intronic
1148526540 17:48342940-48342962 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1148696946 17:49566296-49566318 CAGAGGCCACAGTGGAGGGAGGG + Intergenic
1148737131 17:49871195-49871217 GCCAGGCCACAGGGCAGGGAAGG - Intergenic
1148782101 17:50128350-50128372 CCCTGGACACAATGTAGGGAGGG - Intronic
1148823970 17:50378561-50378583 CCCAGAACACAGCACAGGGAGGG - Intronic
1148828340 17:50411598-50411620 CCCAGGCTAAAGTGCAGTGGTGG + Intergenic
1148928301 17:51107057-51107079 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
1149144916 17:53478796-53478818 CTCAGGGCACAGAGCAGGGTGGG + Intergenic
1149839234 17:59943829-59943851 CCCAGGCTGGAGTGCAGTGAGGG - Intronic
1150090605 17:62321593-62321615 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1150578972 17:66454983-66455005 CCCAGGCAGCAGTGGAGGGAAGG + Intronic
1151476079 17:74344997-74345019 CCCAGGCAACAGCGGAGGGCAGG + Intronic
1151585343 17:75005089-75005111 CCCAGTCCCCAGTGAAGGGGAGG - Exonic
1151638081 17:75366767-75366789 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1151789603 17:76296370-76296392 TCCAGACTGCAGTGCAGGGAGGG + Intronic
1151918820 17:77139209-77139231 CCCAGGCTGGAGTGCAGGGCAGG + Intronic
1151969925 17:77452320-77452342 CCCCGGCCTCAAAGCAGGGAGGG + Intronic
1152029907 17:77835730-77835752 CCCAGGCCAGAGTGCAGTGTTGG - Intergenic
1152045261 17:77930886-77930908 GCCAGGCCACAGCTGAGGGATGG - Intergenic
1152085787 17:78217537-78217559 CCCAGGCTAGAGTGCAGCGACGG + Intronic
1152172741 17:78764066-78764088 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1152204230 17:78965798-78965820 CCCAGGGAAATGTGCAGGGAAGG + Intergenic
1152278336 17:79371119-79371141 CCCAGGCCCCAGTGCAGAGCAGG - Intronic
1152391323 17:80005686-80005708 CCCAGGCCCCAGTCCAGCGACGG - Intronic
1152508732 17:80771125-80771147 CGCAGACCCCAGGGCAGGGAAGG - Intronic
1152529675 17:80910204-80910226 CCCAGGCCACAGTGCAGAGACGG - Intronic
1152569508 17:81115496-81115518 CCCAGCCCACACTGCTGGGAGGG + Intronic
1152579733 17:81160574-81160596 CGCAGGCCACAGTGACAGGAGGG - Intronic
1152685198 17:81690516-81690538 CCCAGGCCACGCCGCTGGGAAGG + Intronic
1152691398 17:81719734-81719756 CCCAGGCCACCGTGCCTGGCTGG + Intronic
1152697151 17:81803192-81803214 CACTGGGCACAGAGCAGGGATGG + Intergenic
1152794244 17:82299044-82299066 CCGAGGCCACCGTCCAGTGAGGG - Intergenic
1152937941 17:83151550-83151572 CCCAGCCCACAGGGCGAGGAGGG + Intergenic
1153021444 18:633112-633134 CCCAGGCTAAAGTGCAGTGGCGG - Intronic
1153033015 18:732679-732701 CCAATGCCACAGTAAAGGGAAGG + Intronic
1153166637 18:2269136-2269158 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
1153282544 18:3427640-3427662 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1153294222 18:3530362-3530384 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1153396898 18:4632789-4632811 TCCAGGTCACAGTGCAGGGAAGG + Intergenic
1153971820 18:10234069-10234091 CTCAGGCCACACTGCATGGCAGG + Intergenic
1153977162 18:10279726-10279748 CCAAGGCCACAGGTAAGGGAAGG - Intergenic
1154121600 18:11656775-11656797 CCCAGGCTAGAGTGCAGGGGGGG - Intergenic
1154358399 18:13640248-13640270 CCCAGGCTGGAGTGCAGGGGCGG - Intronic
1154524805 18:15274912-15274934 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1154529269 18:15328716-15328738 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1154970709 18:21406015-21406037 CCCAGGCCAGAGTGCTGTGGTGG - Intronic
1154973932 18:21438624-21438646 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
1155496233 18:26445607-26445629 TCCAGGCCATGTTGCAGGGAGGG - Intergenic
1156248759 18:35330463-35330485 TCCAGGCCTCAGCACAGGGAGGG - Intergenic
1156901207 18:42302264-42302286 ACTAGGACTCAGTGCAGGGAAGG + Intergenic
1157508896 18:48253515-48253537 TCCAGGCCATAGAGCAGGAAGGG + Intronic
1157788933 18:50512884-50512906 CCCAGAACACAGTAAAGGGATGG - Intergenic
1157986620 18:52445972-52445994 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1158035976 18:53030763-53030785 CCTAGGCCCCAGTGAAGTGAGGG - Intronic
1158229833 18:55242053-55242075 CCCAGCAGACAGAGCAGGGAGGG - Intronic
1158805766 18:60970247-60970269 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1159552270 18:69907357-69907379 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1159917389 18:74199055-74199077 CTCAGGCCACAGTGCAAAGGAGG + Intergenic
1159936858 18:74375901-74375923 CCTGGGCTACAGTCCAGGGAGGG - Intergenic
1160037494 18:75315457-75315479 TCTAGGCCACAGAGCAGGGTGGG - Intergenic
1160156112 18:76435028-76435050 ACCAGGGCACAGGGCAGGGTTGG - Intronic
1160207970 18:76852444-76852466 GACAGGCCACAGTGCTGGGTTGG + Intronic
1160439262 18:78876492-78876514 CCCAGGACGGAGCGCAGGGAAGG - Intergenic
1160509796 18:79447031-79447053 ACGAGGCCACAGTGAAGCGACGG - Intronic
1160510271 18:79449667-79449689 GCCAGGCCGGAGGGCAGGGACGG + Intronic
1160801404 19:971742-971764 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1160875085 19:1293164-1293186 CCCAGGTCACCCTGCAGGGGAGG - Intronic
1160938681 19:1609930-1609952 ACAAGGCCTCAATGCAGGGAGGG + Exonic
1161009726 19:1954408-1954430 CCCAGGTCAGAGGGCAGGGCCGG + Intronic
1161044518 19:2128121-2128143 CCCGGCCCCCACTGCAGGGAAGG - Intronic
1161171600 19:2815011-2815033 CCCAGGCTGCAGTGCAGTGGTGG - Exonic
1161315306 19:3614753-3614775 CCCTGGCCACAGCGGAGGGGAGG + Intronic
1161392744 19:4029686-4029708 CCCAGGCTACAGTGCAGTGGTGG + Intronic
1161462763 19:4408514-4408536 CCCAGGCTACAGTGCAGTGTTGG + Intronic
1161525585 19:4752986-4753008 CCCAGGCCGGAGTGCAGTGGCGG - Intergenic
1162030841 19:7916637-7916659 GCCAGGCCCCAGCGCGGGGAGGG - Exonic
1162350074 19:10143255-10143277 CCCAGGCCGGAGTGCAGTGGTGG + Intronic
1162378046 19:10316600-10316622 CCCGGGCCTCCGTGCAGAGATGG - Exonic
1162379119 19:10321462-10321484 CCGAGGCCACGTAGCAGGGAAGG + Intronic
1162533603 19:11250354-11250376 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1162630146 19:11921214-11921236 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1162881764 19:13665084-13665106 CCCAGGCTGGAGTGCAGTGAGGG - Intergenic
1163047541 19:14655496-14655518 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1163058210 19:14738419-14738441 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1163397592 19:17073110-17073132 CCCTCGCCACAGGGCTGGGATGG + Intronic
1163425153 19:17236744-17236766 CAGAGGCTACAGTGCAGGGAAGG + Intronic
1163464275 19:17457412-17457434 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1163792388 19:19315283-19315305 CCCAGGCCGGAGTGCAGTGGTGG - Intronic
1163815257 19:19461079-19461101 CCCAGCCCACAGTGGAGGCTCGG + Intronic
1164413085 19:28021812-28021834 CTCAGGCCAGAGTGCAGTGATGG + Intergenic
1164487548 19:28672588-28672610 TCCAGGCCTTAGTACAGGGAGGG + Intergenic
1164510828 19:28895874-28895896 CCCATGCCAGAGTGCAGGAGCGG + Intergenic
1164671160 19:30072748-30072770 CCCAGGCTGCAGTGCAGTGGCGG - Intergenic
1164803129 19:31094059-31094081 CCCAGGGTACAATCCAGGGATGG - Intergenic
1164825687 19:31283288-31283310 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1165086729 19:33354277-33354299 CCCAGGCTGCAGTGCAGTGGTGG + Intergenic
1165110495 19:33499427-33499449 CCCAGGGCACAGTCCAGTGCAGG - Intronic
1165404568 19:35621833-35621855 TCAAGGTCACAGGGCAGGGATGG + Intronic
1165534539 19:36432219-36432241 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1165905734 19:39193599-39193621 CCCAGGCTGCAGTGCAGTGGCGG + Intergenic
1165971135 19:39631174-39631196 CCCACGCCACTGTGCTGGGCTGG - Intergenic
1166025709 19:40082630-40082652 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1166051137 19:40260910-40260932 CCCAGGCTGCAGTGCAGTGGTGG - Intronic
1166139324 19:40797584-40797606 CCAAGGCCACAGAGCAGTTACGG - Intronic
1166690080 19:44817192-44817214 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
1166754198 19:45180283-45180305 CCCAGGCTAGAGTGCAGTGGCGG + Exonic
1166761380 19:45226477-45226499 CCCAGGCTGCAGTGCAGTGACGG + Intronic
1166864048 19:45825597-45825619 CTGAGGCCACAGGGCAGGCATGG - Intronic
1166932993 19:46312581-46312603 CCCAGGCCACAGTGGTGTCAGGG + Exonic
1167070716 19:47220784-47220806 CCAAGGCCAGGCTGCAGGGAAGG + Intergenic
1167073972 19:47237729-47237751 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1167076374 19:47252194-47252216 CCCAGGCTAAAGTGCAGTGGCGG + Intergenic
1167372238 19:49090139-49090161 CCCCTGACACAGTGGAGGGAGGG - Intronic
1167522205 19:49961786-49961808 CCCAGGCTACAGTGCAGTGGTGG + Intergenic
1167636463 19:50658783-50658805 CCCAGGCGAGAGGGCAGGGCTGG + Intronic
1167719386 19:51168150-51168172 CCCAGGGCACAGAGCAGGTCAGG - Intergenic
1167721970 19:51185501-51185523 CCCAGGACACAGAGCAGGTCAGG - Intergenic
1167727444 19:51225864-51225886 CCCAGGACACAGAGCAGGTCAGG - Exonic
1167762361 19:51457656-51457678 CCCAGGGCACAGAGCAGGTCAGG + Exonic
1167768471 19:51499633-51499655 CCCAGGGCACAGAGCAGGTCAGG + Exonic
1167811263 19:51833218-51833240 CCCAGGCCACAGAGTAGGAGGGG - Intergenic
1167899152 19:52605406-52605428 CCCAGGCTAAAGTGCAGTGTCGG - Intronic
1167994867 19:53394316-53394338 CCCAGGCTAGAGTGCCGTGATGG - Intronic
1168056200 19:53866580-53866602 CCGAAGCCCCAGGGCAGGGAAGG - Intronic
1168077648 19:53990245-53990267 CGCAGGCCTCAGGGCAGGGCCGG - Intergenic
1202695675 1_KI270712v1_random:123198-123220 CCCACGCCACCGTGCATGGCTGG + Intergenic
924979849 2:209667-209689 CCCCAGGCACAGGGCAGGGAAGG + Intergenic
925094244 2:1182793-1182815 CCCAGGCTAGAGTGCAGTGATGG + Intronic
925358824 2:3262997-3263019 CACAGGCATGAGTGCAGGGAGGG - Intronic
925437919 2:3857219-3857241 TCCAGGCCAAAGGGCAGGGAGGG - Intergenic
925842719 2:8007444-8007466 CCAAGGCCAAATTGAAGGGAAGG - Intergenic
926347312 2:11959597-11959619 CCCAGGGCACAGGGCTTGGAAGG - Intergenic
926640349 2:15229296-15229318 CCCAGGCCAGAATGCAGTGATGG - Intronic
926747783 2:16173472-16173494 CCCAGGCCGGAGTGCAGTGGCGG + Intergenic
926749085 2:16184182-16184204 CCCAGGCTACAGTGCAGTGGCGG - Intergenic
927138901 2:20116342-20116364 CCCAGGTCACACAGCAGGCAAGG - Intergenic
927161254 2:20264740-20264762 TCCAGGCCACAGGGTAGAGATGG + Intronic
927208817 2:20626435-20626457 CCAAGGCCACACAGCAGGGAAGG + Intronic
927648404 2:24895667-24895689 CCCAAGCTAGAGTGCAGTGATGG + Intronic
928613376 2:33012252-33012274 CCAAGGGCACAGAGCTGGGATGG + Intronic
929611372 2:43273207-43273229 CCCAGGCGAGAGTGCAGTGGTGG - Intronic
929938346 2:46311332-46311354 CTCAGGCCCGAGAGCAGGGAAGG + Intronic
930002386 2:46869962-46869984 CCCAGGTCCCAGGGCAGGAAGGG - Intergenic
930005020 2:46889731-46889753 CCCAGGCTGGAGTGCAGTGAGGG - Intergenic
930452686 2:51562167-51562189 CCCATGCTGCAGTGCAGGGGTGG + Intergenic
930564717 2:53004884-53004906 CCCAGGCTGCAGTGCAGTGGTGG + Intergenic
931327299 2:61239966-61239988 CCCAGGCTGGAGTGCAGTGACGG - Intronic
931471547 2:62543082-62543104 CCCAGGCTGGAGTGCAGGGGCGG - Intergenic
933199756 2:79435454-79435476 CCCAGGCCACACTGCAGAAATGG + Intronic
933693188 2:85195587-85195609 CCCAAGCTAGAGTGCAGTGATGG + Intronic
933784988 2:85831976-85831998 CCCAGGCTAGAGTGCAGTGGAGG + Intergenic
933954081 2:87353052-87353074 GCCAGGCCACAGTGAGGGCAGGG - Intergenic
933973199 2:87486795-87486817 CCCAAGGAGCAGTGCAGGGATGG + Intergenic
933983017 2:87568954-87568976 CCCTTGCCACAGTGCAGTGCTGG + Intergenic
934085451 2:88505483-88505505 CCCAGGCCGGAGTGCAGTAATGG + Intergenic
934276837 2:91580239-91580261 CCCACGCCACCGTGCATGGCTGG + Intergenic
934502983 2:94873698-94873720 CCCAGGTCACAGTGGAGCGCAGG + Intronic
934522831 2:95030656-95030678 CCCAGGCCACAAAGGAGGCAGGG + Intronic
934688567 2:96339546-96339568 CCCAGGCTGGAGTGCAGTGACGG - Intronic
934794137 2:97086095-97086117 CCCAGGCCAGAGTGCAGCAGAGG - Intronic
934880584 2:97973422-97973444 ACTAGGCCACAGTGCAGGGAGGG + Intronic
935186314 2:100736714-100736736 TCCAGGCCCTGGTGCAGGGATGG + Intergenic
935217275 2:100984081-100984103 CCTATGCCACAGTGCACTGAGGG + Intronic
935225613 2:101049867-101049889 CCCAGGCTGGAGTGCAGTGACGG + Intronic
935284931 2:101556189-101556211 CCCAGGCCTGACTGCAGGGTGGG - Intergenic
935730911 2:106064632-106064654 CCCAGGCTGGAGTGCAGTGATGG - Intronic
936287870 2:111195008-111195030 GGCAGGCCACACCGCAGGGAGGG - Intergenic
936310827 2:111381841-111381863 CCCTTGCCACAGTGCAGTGCTGG - Intergenic
936320522 2:111463418-111463440 CCCAAGGAGCAGTGCAGGGATGG - Intergenic
936574059 2:113638847-113638869 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
937025681 2:118695526-118695548 CCCAGGCTGCAGTGCAGTGGTGG - Intergenic
937256450 2:120559334-120559356 CTCAGGAAACAGTGCAGGGTTGG + Intergenic
937286553 2:120757774-120757796 TCCAGGCCACGGCACAGGGAGGG - Intronic
937309821 2:120895124-120895146 GCCAGGCCAGCCTGCAGGGATGG - Intronic
937356308 2:121200150-121200172 GCCAGGCGACAGGGAAGGGATGG + Intergenic
937378136 2:121351984-121352006 CTCAGGCCACAGAGCTGAGAAGG + Intronic
937486948 2:122324976-122324998 CCCAGGCTAGAGTGCAGAGGTGG - Intergenic
938033751 2:128018440-128018462 CCCAGGCTAGAGTGCAGTGACGG - Intronic
938116185 2:128604236-128604258 CCCAGGCCAGAGCCCAAGGAAGG + Intergenic
938422681 2:131156882-131156904 CCCAGGCCACACAGCAGGGACGG + Intronic
938528365 2:132160142-132160164 CCCAGGCTAGAGTGCAGTGATGG + Intronic
938950497 2:136250353-136250375 CACTGGCCACAGAGCAGGGTGGG - Intergenic
938951206 2:136256450-136256472 CCTCTGCCCCAGTGCAGGGACGG + Intergenic
938988595 2:136604874-136604896 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
939270886 2:139937869-139937891 TTCAAGTCACAGTGCAGGGAAGG - Intergenic
939719858 2:145635046-145635068 CCCAGGCTGCAGTGCAGTGGCGG + Intergenic
939765081 2:146238433-146238455 CCCATGCCCCAGGTCAGGGAAGG + Intergenic
939902627 2:147868672-147868694 CCCAGGCTGGAGTGCAGTGACGG + Intronic
940228852 2:151429221-151429243 CCCAGGCTGGAGTGCAGTGATGG + Intronic
940232632 2:151473334-151473356 CCCAGGCCAGAGTGCAGGTGGGG + Intronic
940285842 2:152032282-152032304 CCCAGGCCACACAGCCAGGAAGG + Intronic
940316119 2:152329454-152329476 CCTAGGGCACAGTGCAAAGAAGG - Intergenic
940648463 2:156416388-156416410 CTCAGGCCAGAGTGCAGTGGTGG + Intergenic
941089074 2:161153642-161153664 CCCAGGCTGGAGTGCAGGGCAGG - Intronic
941988669 2:171533322-171533344 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
942332002 2:174836153-174836175 TCCAGGCCACAGCACATGGAGGG - Intronic
944111934 2:196141614-196141636 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
944633566 2:201652816-201652838 CTAAGGCTAGAGTGCAGGGAGGG + Intronic
944800926 2:203237194-203237216 CCCAGGCTAGAGTGCAGTGACGG - Intergenic
945339477 2:208634799-208634821 CCCAGGCTACATGGCAGGGAAGG - Intronic
945452799 2:210013350-210013372 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
946279157 2:218653890-218653912 CCCAGGCTGCAGTGCAGTGGTGG + Intronic
946295706 2:218782106-218782128 CCCAGACAGCAGTGCAGGGCGGG - Exonic
946932863 2:224688649-224688671 CCCAGGCTGGAGTGCAGTGAGGG + Intergenic
947529365 2:230899006-230899028 GCCAGGGCACACTGCAGGAAAGG + Intergenic
947717520 2:232349345-232349367 CCCAGGCCACAGTGTGGGTTTGG - Intergenic
947876285 2:233470168-233470190 CCCAGCCCACAGTGGGGGGAGGG - Exonic
948108056 2:235430836-235430858 CCCAGGCAACAGGGCAAAGATGG + Intergenic
948384035 2:237570680-237570702 CCCAGGCTGTAGTGCAGTGATGG - Intergenic
948556053 2:238812211-238812233 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
948838288 2:240636750-240636772 CACAGGCCACACCGCAGGGCTGG - Intergenic
948914244 2:241023930-241023952 CCCAGGCTGGAGTGCAGTGACGG + Intronic
948930020 2:241126137-241126159 CCCAGAGCACAGTGCAGTGGGGG - Intronic
948948830 2:241235957-241235979 CCCAAGGGACAGGGCAGGGAAGG - Intronic
1169298466 20:4421109-4421131 CCCAGGCCAGAGTGCAGCAGTGG + Intergenic
1169417406 20:5429265-5429287 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1169463520 20:5817902-5817924 CCTAGACCACAGCGCAGGGAAGG - Intronic
1169812110 20:9618963-9618985 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1170263756 20:14442225-14442247 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1170288653 20:14742807-14742829 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1170409904 20:16077760-16077782 CCCAGGCTAAAGTGCAGTGGGGG - Intergenic
1170543311 20:17410816-17410838 TCCAGGGCACAGTGCTGAGAAGG + Intronic
1170607652 20:17885850-17885872 CCCAGGACACAGAGCAGACAGGG + Intergenic
1170776073 20:19375658-19375680 TGCAAGCCACAGTGCAGAGATGG - Intronic
1171005614 20:21462702-21462724 CCCAGGGCACAGAGCAGAGCAGG + Intergenic
1171150376 20:22822255-22822277 GCCAGGCCACAGGGCAGACATGG - Intergenic
1171420030 20:25011860-25011882 CCCAAGCCACTGGGCAGGGCAGG + Intronic
1171423816 20:25036910-25036932 CCCAGGCTGCAGTGCAGTGATGG - Intronic
1171448464 20:25220686-25220708 TCCAGGCCAGAGTCCAGGGATGG + Intronic
1171482665 20:25465642-25465664 CCCACATCACAGAGCAGGGACGG + Intronic
1171946612 20:31383798-31383820 CCCAGGCTGCAGTGCAGTGGTGG - Intronic
1172185796 20:33030297-33030319 GCCAGGCAACAGAGCTGGGAGGG - Intergenic
1172188747 20:33048970-33048992 CCCATGCCACAGAGGAAGGAGGG + Intergenic
1172244833 20:33438735-33438757 CCCAGCCCCCAGTGCTGGGATGG + Intronic
1172846130 20:37930896-37930918 CGCAGGCAACAGGGCAGGGCAGG + Intronic
1172870038 20:38130107-38130129 CCCAGACCCCAGGGCAGGGTGGG - Exonic
1172990323 20:39031374-39031396 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1173107294 20:40150031-40150053 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1173468232 20:43301460-43301482 TCCAGGACACAGAGAAGGGAAGG + Intergenic
1173562954 20:44019436-44019458 CCCAGGCCTCTGAGCTGGGATGG + Intronic
1173607889 20:44344738-44344760 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1173613630 20:44388781-44388803 CCCAGGGCGCAGGGCAGGGCAGG - Intronic
1174263004 20:49310933-49310955 TCCAGCCCACACTTCAGGGAAGG + Intergenic
1174329293 20:49805034-49805056 CCCAGGCTACAGTGCAGTTGTGG - Intergenic
1174565126 20:51458980-51459002 CCAGGGTCACAGAGCAGGGATGG - Intronic
1174623447 20:51894833-51894855 ACCAGGCCACAGGGCAGGAAGGG - Intergenic
1174701254 20:52611388-52611410 CCCAGGCTGCAGTGCAGTGGTGG + Intergenic
1174755621 20:53155525-53155547 CCCAGGGCACAGGTCTGGGAAGG + Intronic
1175105459 20:56611593-56611615 GCCAGGCCACAGAGGAGGGCAGG - Intergenic
1175203407 20:57292891-57292913 CCCAGACCAGTGTGCAGGGGAGG + Intergenic
1175386425 20:58598356-58598378 CCCAGCCCACACTGGAGGGGCGG - Intergenic
1175411002 20:58769015-58769037 AAGGGGCCACAGTGCAGGGAAGG + Intergenic
1175548691 20:59801227-59801249 GCCAGGCCACAATCCAGGGAGGG - Intronic
1175570163 20:60012200-60012222 TCCAGGGCACAGGACAGGGAAGG + Intronic
1176768130 21:13039763-13039785 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1176772639 21:13093570-13093592 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1177575360 21:22948063-22948085 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1178023095 21:28432421-28432443 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
1178076398 21:29016999-29017021 CCCAGGCCAGAGTGCAGAGTCGG + Intronic
1178325889 21:31645335-31645357 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1178850248 21:36207225-36207247 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1178958260 21:37042356-37042378 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1179056672 21:37942501-37942523 CCCAGGCCAGAGTGCAGTGGTGG - Intergenic
1179220597 21:39403662-39403684 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1179279340 21:39921069-39921091 CCCAGCCCCCAGGACAGGGATGG + Intronic
1179498894 21:41794408-41794430 CCCAGGCCACAGTGCAGAGAGGG - Intergenic
1179554789 21:42165567-42165589 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1179600332 21:42473749-42473771 CCCAGGCCACAGTGTCAGGAGGG - Intronic
1179791030 21:43756044-43756066 TCCAGGCCACGGTGCTGTGAGGG + Exonic
1179815076 21:43900473-43900495 CTCCAGCCACAGGGCAGGGAGGG + Intronic
1179836810 21:44040383-44040405 CTCAGGCCAGAGTGCAGTGGTGG + Intronic
1179982978 21:44906014-44906036 CCCAGGCCACAGTGAGGCCAGGG - Intronic
1180045153 21:45301781-45301803 CCCAGGCCACAGGGCACTCAGGG + Intergenic
1180210275 21:46291635-46291657 CCCATGCCACAGTTGAAGGAGGG + Intronic
1180235208 21:46454922-46454944 CACAGGCCACCGTGCCTGGATGG + Intergenic
1180432693 22:15266053-15266075 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1180437436 22:15323075-15323097 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1180625463 22:17190878-17190900 CCCAGGCCCCATGGAAGGGAAGG + Intronic
1180658730 22:17447075-17447097 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1180862830 22:19096750-19096772 CCCAGGCCAGAGTGCAGTGGTGG + Intronic
1180976035 22:19848968-19848990 GCCAGGCCACAGTGCACTGGAGG + Exonic
1181009452 22:20032018-20032040 CCCAGGTCACATGGCAGGGATGG - Intronic
1181179210 22:21055384-21055406 CCCAGCCCACAGAGGAGGAAGGG - Intronic
1181423477 22:22817969-22817991 CCCAGAGCAAAGGGCAGGGAGGG - Intronic
1181459053 22:23075634-23075656 TAAAAGCCACAGTGCAGGGAGGG + Intronic
1181461535 22:23088819-23088841 CCCAGGCCACAGGGCCAGCAAGG - Intronic
1181689936 22:24553608-24553630 CCCAAGCCACAGAGTAAGGAGGG - Intronic
1181733536 22:24864884-24864906 CTCAGGCCACAGAGCTAGGAAGG - Intronic
1181823299 22:25493011-25493033 CCCAGCACTCAGTACAGGGATGG + Intergenic
1181957655 22:26599806-26599828 CCCAGGGCACAGAGCAGGAAGGG - Intronic
1182008378 22:26980192-26980214 GCCAGACCTCACTGCAGGGAAGG - Intergenic
1182063835 22:27416738-27416760 CCCTGGCCTCTGAGCAGGGAGGG - Intergenic
1182463089 22:30495877-30495899 CCTGGGTCACAGTGCATGGAAGG + Intronic
1182514218 22:30843914-30843936 CCCAGGCCGGAGTGCAGTGGAGG + Intronic
1182696249 22:32200995-32201017 CGCAGGAAACAGTGCAAGGAGGG + Intronic
1183063165 22:35347650-35347672 CCCATGCAGCAGAGCAGGGAAGG - Exonic
1183118217 22:35708373-35708395 CCCAGGCTGCAGTGCAGTGGTGG - Intergenic
1183350027 22:37329862-37329884 CCCAGGCCCCAGTGAGGGGGAGG + Intergenic
1183387090 22:37520996-37521018 CCAAGGCCACAGAGAGGGGAAGG - Intergenic
1183485157 22:38084466-38084488 CCCAGGCCACATTCCAGGAGGGG + Intergenic
1183491457 22:38118794-38118816 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1183513117 22:38247419-38247441 CCCAGGGCCCAGTGCAGCGCAGG - Intronic
1183562227 22:38584240-38584262 CACAGGGCCTAGTGCAGGGATGG + Intronic
1183626277 22:39004292-39004314 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1183687065 22:39367285-39367307 CCCAGGCCCCAGGGCAGGGCAGG + Intronic
1184381179 22:44145666-44145688 CACAGTCCACAAGGCAGGGAGGG - Intronic
1184616842 22:45644213-45644235 CCCAGGCTAGAGTGCAGTGGCGG - Intergenic
1184641096 22:45870680-45870702 CCCCGGCCATGGTGCAGGCAGGG + Intergenic
1184723567 22:46329969-46329991 GCCAGTCCTCTGTGCAGGGAGGG + Intronic
1184758454 22:46531246-46531268 CCCAGGCTACAGTGCAGCAGTGG + Intronic
1184817870 22:46885705-46885727 CCCTGCCCACAGTGATGGGAAGG - Intronic
1184888820 22:47367244-47367266 CACAGGCAAGAGTACAGGGAAGG - Intergenic
1184919954 22:47599122-47599144 CCCAGGACACTCTGCAGGGATGG + Intergenic
1185067382 22:48639061-48639083 CCCAGGCCCCAGCTCAGAGATGG + Intronic
1185069381 22:48647819-48647841 CCCAGGAGAGAGTGCAGGGAGGG + Intronic
1185135516 22:49069660-49069682 CCCAGGCTGCAGTGCAGTGGTGG + Intergenic
1185146852 22:49141830-49141852 TCCAGGCCAGACTGCAGGTAAGG - Intergenic
1185426114 22:50772045-50772067 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
949668580 3:6370745-6370767 CACGGGCCAGAGTGGAGGGATGG - Intergenic
949810504 3:8001719-8001741 GCCAAGCCACACAGCAGGGATGG - Intergenic
949988317 3:9556665-9556687 CCCAGGCTGCAGTGCAGTGGTGG - Intergenic
950027329 3:9829157-9829179 CCCAGGACACCGTGCAGTGTCGG + Exonic
950090379 3:10290529-10290551 CCCAGGGCACTCAGCAGGGAGGG + Intronic
950301107 3:11879933-11879955 CCCAGGCTAGAGTACAGTGATGG + Intergenic
950518563 3:13482839-13482861 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
950822091 3:15771365-15771387 CCCAGGCTGCAGTGCAGTGGCGG - Intronic
950957254 3:17067470-17067492 CCAAGCCCACAGTACAAGGATGG - Intronic
951087139 3:18526216-18526238 TCCAGGCCAGAGAACAGGGAGGG - Intergenic
951332571 3:21384189-21384211 CCCAGGCTAGAGTGCAGTGGAGG - Intergenic
951476565 3:23112755-23112777 CTCAGGCTGCACTGCAGGGAGGG - Intergenic
951679012 3:25274924-25274946 CCTTGCCCACAGTGGAGGGAAGG + Intronic
951877684 3:27445369-27445391 TCCAGGCCACAGCACAGGGAGGG - Intronic
952030101 3:29131628-29131650 CCCAGGCCGGAGTGCAGTGGCGG + Intergenic
952318062 3:32249081-32249103 CCCAGGCCGCACTGCAGGCCTGG + Intronic
952576990 3:34787233-34787255 TCCAGGCTACAGCACAGGGAAGG + Intergenic
952927090 3:38328220-38328242 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
953028780 3:39162255-39162277 CCCAGGCTGCAGTGCAGTGGTGG + Intergenic
953235970 3:41107467-41107489 CCCAGGCTGGAGTGCAGGGGCGG + Intergenic
953387118 3:42512990-42513012 CCCTGGCCAGGGTACAGGGAGGG + Intronic
953411674 3:42693722-42693744 CCCAAGCCACAGTGTGGTGATGG + Exonic
953892175 3:46759691-46759713 TCCAGGCCACAGTACAGAGAAGG + Intronic
953987153 3:47453051-47453073 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
954004547 3:47580327-47580349 TCCAGACCACAGTTCTGGGATGG - Exonic
954078497 3:48198556-48198578 CCCAGGCCAGAGTGCAGCAGTGG + Intergenic
954167666 3:48773384-48773406 CCCAGGCTGGAGTGCAGGGGCGG + Intronic
954245126 3:49325396-49325418 CCCAGGCTGCAGTGCAGTGGTGG + Intronic
954302033 3:49705273-49705295 GCCAGGCCACAGGGCTGGGAGGG - Intronic
954826922 3:53381773-53381795 CCCAGGCTGCAGTGCAGAGGTGG - Intergenic
955735879 3:62037753-62037775 CCCAGGTCAAAATGCAGGCAAGG + Intronic
955986074 3:64575321-64575343 CCAAGGTCACACAGCAGGGAAGG + Intronic
956133470 3:66075992-66076014 CCCAGTCCAGAGTGCAGTGACGG + Intergenic
956439512 3:69266157-69266179 CCCAGGCTGGAGTGCAGTGATGG - Intronic
956452289 3:69386333-69386355 CCCAGGGCGCGGGGCAGGGACGG + Intronic
957027075 3:75193999-75194021 TTCAAGCCACAGTGTAGGGAGGG + Intergenic
957823822 3:85413905-85413927 CCCAGGCTGCAGTGCAGTGGTGG + Intronic
958492792 3:94798751-94798773 CCCAGGCCAGAGTGCAATGGTGG - Intergenic
958814568 3:98901533-98901555 CCCAGGCCGGAGCGCAGGGGAGG + Exonic
959072854 3:101719241-101719263 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
960892794 3:122468222-122468244 TCCAGGCTGCAGTGCAGGAAAGG + Intronic
961153328 3:124658112-124658134 CCCAGGCTGGAGTGCAGGGTGGG - Intronic
961217568 3:125172229-125172251 CCCAGGCCGGAGTGCAGTGGCGG - Intronic
961354682 3:126329440-126329462 CCCAGGCTGGAGTGCAGAGATGG - Intergenic
961387313 3:126529954-126529976 CCTAGGGCCCAGTGGAGGGACGG + Intronic
961687674 3:128645775-128645797 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
962060247 3:131918991-131919013 CCCAGGAAACAGTGCAGTGTAGG + Intronic
962542944 3:136401818-136401840 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
962588991 3:136869500-136869522 CCCAGGCTAAAGTGCAGTGGCGG - Intronic
962708961 3:138069785-138069807 CCCAGGCCACAGAAGAGGCAGGG + Intronic
962717762 3:138141920-138141942 TCTAGGCCACAGTACAGGGAGGG + Intergenic
963041222 3:141071442-141071464 CCCAGGGCACAGAACATGGATGG - Intronic
963246746 3:143071078-143071100 CTCAGGCAAAACTGCAGGGAAGG - Intergenic
963402681 3:144821045-144821067 CCCTGGCAAAAATGCAGGGAAGG - Intergenic
964487073 3:157197164-157197186 CCCAGGCCAGAGTGCAGTGGTGG + Intergenic
964513705 3:157482264-157482286 CCCAGGCTGGAGTGCAGTGATGG + Intronic
964870229 3:161305964-161305986 CCCAGGCTAGAGTGCAGCGGTGG + Intergenic
964937044 3:162102537-162102559 CCTAGGCTGCAGTGCAGTGATGG - Intergenic
964978675 3:162650292-162650314 CCCAGGCTATAGTGCAGTGGTGG - Intergenic
966002863 3:174971738-174971760 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
966378485 3:179321257-179321279 CCCAGGCTCCAGTACAGAGATGG - Intergenic
966542449 3:181107090-181107112 CCCAGGCCGGAGTGCAGTGGTGG - Intergenic
966599435 3:181760781-181760803 CCCAGGCTAGAGTGCAGTGATGG + Intergenic
966627786 3:182037147-182037169 GCCAGGCCACAGAGCTGTGAGGG + Intergenic
966650731 3:182297987-182298009 CACTGGACAAAGTGCAGGGAGGG - Intergenic
966813027 3:183865263-183865285 CCTAGGCCTCAGTGCAGTAATGG - Intronic
966858232 3:184211163-184211185 CCTAGGCCCCAGTGCAGTGGCGG - Intronic
967325131 3:188231185-188231207 TCCAGGCCACACTGAAGGGGAGG + Intronic
967386275 3:188914191-188914213 CCCAGGCTATAGTGCAGTGGAGG - Intergenic
967640023 3:191851263-191851285 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
967832803 3:193935386-193935408 ACCAGGTCACCGTGCAAGGAGGG + Intergenic
967976676 3:195039325-195039347 CCCAGCTCACAGGGCAGGAAGGG - Intergenic
968348650 3:198033457-198033479 CCCAGGCTGGAGTGCAGTGATGG + Intronic
968352247 3:198068152-198068174 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
968441383 4:626247-626269 GCCAGGGCACAGTGCCGGGAGGG - Intronic
968454159 4:688790-688812 CCCAGGGCACAGAGCAGGGCTGG - Intronic
968456120 4:700894-700916 CAGAGTCCACAGGGCAGGGACGG - Intergenic
968495535 4:913376-913398 CCCCTGCCACAGGGCAGGCAGGG + Intronic
968596072 4:1486116-1486138 TCCAGACCATGGTGCAGGGAGGG - Intergenic
968641475 4:1717121-1717143 CCAAAGCCACAGGGCAGGGAAGG - Exonic
968739354 4:2319549-2319571 CCCAGGCCACAGAGCCAGGGTGG + Intronic
968980985 4:3849208-3849230 CCAAGGCCACCCTGCAGGGCTGG - Intergenic
969079210 4:4605433-4605455 CCCAGGCTGCAGTGCAGGTGCGG + Intergenic
969264628 4:6056404-6056426 CCCAGGCCACTCTGCAGAAATGG - Intronic
969297812 4:6279975-6279997 CCAAGGCCACAGAGCCAGGATGG - Intronic
969346289 4:6572341-6572363 CCCAGGCCAGAGTGCAGTGGTGG - Intergenic
970501487 4:16681667-16681689 CCCAGGCTGGAGTGCAGTGATGG + Intronic
970804614 4:20016425-20016447 CCCAGGCCAGAGTGCAGTGGTGG + Intergenic
970905486 4:21211548-21211570 CCTAGGCGACAGTGGAGGGATGG - Intronic
970959009 4:21851161-21851183 CACAGGCATTAGTGCAGGGAGGG + Intronic
971105126 4:23516131-23516153 GCCAGGCCAGAGTGCAGTGGCGG - Intergenic
971423969 4:26498511-26498533 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
971697321 4:29922985-29923007 CCCAGGCTAGAGTGCAGTGGAGG - Intergenic
972427736 4:38950284-38950306 CACAGGACAGAGAGCAGGGAGGG - Intergenic
972450948 4:39197879-39197901 CCCAGGCCAGAGTGCAGTGGTGG + Intronic
972457049 4:39264958-39264980 CCCAGGCCGGAGTGCAGGGACGG + Intronic
972563189 4:40246624-40246646 CCCAGGGCTCAGCACAGGGAAGG + Exonic
972650307 4:41011471-41011493 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
972734131 4:41823658-41823680 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
973807301 4:54538770-54538792 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
973867177 4:55125583-55125605 CCCGGGACTCAGTGCAGGGTGGG + Exonic
974246436 4:59325760-59325782 CCGAGGCCAGAGTGCAGTGGCGG + Intergenic
974681776 4:65173945-65173967 CCCAGGCTGGAGTGCAGGGGTGG + Intergenic
974859080 4:67497573-67497595 CCCAGGCTGCAGTGCAGTGGTGG + Intronic
975504887 4:75126549-75126571 GCCAGCTCACACTGCAGGGAGGG + Intergenic
975798975 4:78038862-78038884 TCCAGGCCACAGCGCAGGCAGGG + Intergenic
975990761 4:80257693-80257715 CGCAGGCTAGAGTGCAGTGATGG - Intergenic
976463311 4:85338311-85338333 TCCAGGCCATGGTGCAGGGAGGG + Intergenic
976763257 4:88572381-88572403 CCCAGGCTGGAGTGCAGTGATGG - Intronic
977371970 4:96148790-96148812 CCCAGGCTGCAGTGCAGTGGCGG - Intergenic
978471524 4:109072957-109072979 CCCAGAACACAGTGGAGGAATGG - Intronic
978944193 4:114474516-114474538 TCCAGGCCACAGCACAGGGAGGG - Intergenic
979528733 4:121745166-121745188 CCCAGGCCGGAGTGCAGCGGTGG - Intergenic
980303357 4:131023320-131023342 CCCAGGCCAGAGTGCAGTGGCGG - Intergenic
980336532 4:131481366-131481388 CCCAGGCTGCAGTGCAGTGGTGG + Intergenic
980585483 4:134809100-134809122 CCCAGGCTAAATTGCAGTGACGG - Intergenic
980976129 4:139612127-139612149 CCCAGGCCAGAGTACAGTGATGG - Intergenic
981038640 4:140198566-140198588 TTCAGGCCACAATACAGGGAGGG + Intergenic
981043180 4:140241933-140241955 CTAGGGCAACAGTGCAGGGAGGG - Intergenic
981320813 4:143388994-143389016 CCCAGTCCACTCTGCAGAGAAGG + Intronic
981525888 4:145706852-145706874 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
981681825 4:147408171-147408193 CCCAGGCTGGAGTGCAGGCATGG - Intergenic
981704353 4:147643222-147643244 CCCAGGCTATAGTGCAGTGGCGG - Intronic
981843415 4:149138206-149138228 GCCTGGCCACAGGGCAGGGATGG + Intergenic
981975709 4:150724796-150724818 CCCAGGCTGCAGTGCAGTGGTGG - Intronic
982030189 4:151293075-151293097 CCCAGGCTGGAGTGCAGTGATGG - Intronic
982070384 4:151689093-151689115 CCCAGTTCACAGCTCAGGGATGG - Intronic
983131832 4:164029635-164029657 CCCAGGCTGCAGTGCAGTGGTGG + Intronic
983209047 4:164939981-164940003 CAAAGGCCATGGTGCAGGGAGGG + Intergenic
983209931 4:164948066-164948088 CAAAGGCCATGGTGCAGGGAGGG - Intergenic
983210959 4:164957087-164957109 CCCAGCCCACCCTGCAGGGCTGG - Exonic
983500659 4:168495677-168495699 CCCAGGCTGGAGTGCAGTGATGG + Intronic
983506277 4:168557084-168557106 CCCAGGCTGGAGTGCAGTGACGG + Intronic
984265405 4:177492612-177492634 CCCAGGCCGGAGTGCAGTGGCGG + Intergenic
984409730 4:179381337-179381359 CCCAGGCCAGAGTGCAGTGATGG + Intergenic
984526434 4:180864185-180864207 CCCAGGCCAGAGTGCAGTGGTGG + Intergenic
984975729 4:185228577-185228599 CCCAGGCTAGAGTGCAGAGGAGG + Intronic
985030473 4:185784172-185784194 CCCAGGCTAGAGTGCAGTGACGG + Intronic
985158509 4:187019105-187019127 TCCAGAGCACAATGCAGGGAAGG + Intergenic
985278822 4:188267452-188267474 CCCAGGCTGGAGTGCAGGGGCGG + Intergenic
985491566 5:182725-182747 TGCAGGCCTCAGTGCAGGGAGGG + Exonic
985655846 5:1131000-1131022 CCCAGGACACAGAACAGGGAGGG + Intergenic
986300227 5:6472605-6472627 ACCCGGACACAATGCAGGGAAGG - Intronic
986338037 5:6769391-6769413 TGCAGCCCACTGTGCAGGGATGG + Intergenic
987055453 5:14186495-14186517 CCCATGCCTCTGTGCAGGTAAGG - Intronic
987372531 5:17206706-17206728 CCCAGGCTGGAGTGCAGTGATGG - Intronic
988062913 5:26196992-26197014 CCCAAACCACAGGGCAGGGCAGG - Intergenic
988170969 5:27654578-27654600 CCCAGGCTGGAGTGCAGGGGCGG - Intergenic
988509312 5:31852637-31852659 CCCAGGCTGGAGTGCAGTGATGG + Intronic
988811324 5:34787954-34787976 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
989002684 5:36777273-36777295 TCCAGGCTGCAGTACAGGGAAGG + Intergenic
989268855 5:39508420-39508442 CCCAGGCCATTGTGGAGGGTGGG - Intergenic
990343846 5:54851862-54851884 CCCAGATCACTTTGCAGGGAGGG + Intergenic
990457843 5:56005228-56005250 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
990563527 5:57006571-57006593 CCCAGGCTAGGGTGCAGTGATGG - Intergenic
991245629 5:64506128-64506150 GCCTGGCGACAGTGGAGGGAGGG + Intergenic
991422948 5:66460011-66460033 CTGAGGCCACAGTTCATGGAAGG - Intergenic
991532587 5:67632442-67632464 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
991747368 5:69757761-69757783 CCCAGGCTGCAGTGCAGTGGCGG - Intergenic
991750336 5:69797481-69797503 CCCAGGCTGCAGTGCAGTGGCGG + Intergenic
991798971 5:70337714-70337736 CCCAGGCTGCAGTGCAGTGGCGG - Intergenic
991801909 5:70377304-70377326 CCCAGGCTGCAGTGCAGTGGCGG + Intergenic
991826744 5:70633036-70633058 CCCAGGCTGCAGTGCAGTGGCGG - Intergenic
991829624 5:70672367-70672389 CCCAGGCTGCAGTGCAGTGGCGG + Intergenic
991891302 5:71337034-71337056 CCCAGGCTGCAGTGCAGTGGCGG - Intergenic
991930855 5:71751271-71751293 AGAAGGGCACAGTGCAGGGAAGG - Intergenic
992083562 5:73258186-73258208 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
992161390 5:74007081-74007103 TCCAGACCACAATACAGGGAGGG - Intergenic
992713119 5:79481425-79481447 TCCAGACCACAGCACAGGGAAGG + Intronic
992788023 5:80188238-80188260 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
993139192 5:84008853-84008875 CCCAGGCTAGAATGCAGTGATGG + Intronic
993504441 5:88693202-88693224 CCCGGGGCGCAGTGTAGGGAAGG - Intergenic
993706994 5:91182463-91182485 TCCAGGTGACAGTCCAGGGAGGG + Intergenic
994670483 5:102756026-102756048 CCAAGGCCACAGAGCTGGGAAGG - Intronic
994704288 5:103181527-103181549 CCCAGGCTGCAGTGCAGTCAGGG - Intronic
995504962 5:112850934-112850956 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
995885341 5:116888232-116888254 CCCAGGTCTCACTGCAGGAAGGG - Intergenic
996748117 5:126863619-126863641 CCCAGCCAACAGTGCTGTGATGG - Intergenic
997147413 5:131451544-131451566 CCCAGGCCGAAGTGCAGTGGTGG - Intronic
997314786 5:132923306-132923328 TCCAGGCCGCAGTGCAGTGGCGG - Intronic
997335708 5:133107767-133107789 CCCAGGCTGCAGTGCAGTGGCGG + Intergenic
997416938 5:133736208-133736230 TTCTGTCCACAGTGCAGGGAAGG + Intergenic
997625502 5:135328196-135328218 CCAAGGGCACAGGGCAGGGCAGG - Intronic
997873424 5:137525703-137525725 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
998006059 5:138657768-138657790 CCCAGACCCCAGGGAAGGGAGGG - Intronic
998017088 5:138740934-138740956 CCCAGGCTGGAGTGCAGTGACGG + Intronic
998154132 5:139774844-139774866 CGCAGGGCACAGGGGAGGGACGG + Intergenic
998273620 5:140730539-140730561 CCCAGGCAAGAGTGCAGTGGGGG + Intergenic
998378546 5:141707844-141707866 CCCAGGCCCCTGTTCAGAGAAGG - Intergenic
998383933 5:141745358-141745380 CCCTGGGCACAGGGCAGGGAGGG - Intergenic
999071793 5:148750805-148750827 GCGAGGCCAGAGTGCAGAGATGG + Intergenic
999114452 5:149150136-149150158 CCCAGGGCACAGTCCAGAGTAGG + Intronic
999193272 5:149764350-149764372 CCCAGCCTCCAGTGCAGGGCTGG - Intronic
999313339 5:150568080-150568102 CCCAGGCGAGAGTGCAGTGATGG + Intergenic
999709427 5:154303257-154303279 TCCAGGCCATGGTACAGGGAGGG + Intronic
999742382 5:154566142-154566164 CCCAGGGCACAGAGCTGGGTGGG - Intergenic
999835965 5:155373059-155373081 TCCAAGCTACAGTACAGGGAAGG - Intergenic
999950330 5:156642510-156642532 CCCAGGCTAGAGGGCAGTGATGG + Intronic
1000393727 5:160751021-160751043 CACAGGGCACACTGCAGGCAGGG - Intronic
1000457847 5:161474093-161474115 CCAAGGCCCTAGAGCAGGGATGG + Intronic
1001495471 5:172185189-172185211 GCCAGGACACACTGCGGGGAAGG + Intronic
1001932936 5:175686033-175686055 CCGAGGCCACAGTTCAGTGCCGG - Exonic
1001980004 5:176031432-176031454 GCCAGGGCCCAGGGCAGGGAGGG + Intronic
1002044634 5:176535022-176535044 CCCACTCCCCAGGGCAGGGAAGG + Intronic
1002155911 5:177279453-177279475 CCCAGGCTGCAGTGCAGTGGCGG - Intronic
1002184317 5:177447108-177447130 CCCAGTCCACACCGGAGGGAGGG + Intronic
1002237378 5:177812231-177812253 GCCAGGGCCCAGGGCAGGGAGGG - Intergenic
1002276054 5:178104974-178104996 GCCAGGGCCCAGGGCAGGGAGGG + Intergenic
1002419498 5:179138236-179138258 CCCAGGCATCAGTGCTGGGGAGG - Intronic
1002453607 5:179333008-179333030 CCAAGGCCACACAGTAGGGAGGG - Intronic
1002687973 5:181029408-181029430 CCCAGGCCGGAGTGCAGTGGGGG - Intergenic
1002720166 5:181254415-181254437 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1002727906 5:181312922-181312944 CCCAGGGTGGAGTGCAGGGATGG + Intergenic
1002920401 6:1565660-1565682 CCCAGGCTGCAGTGCAGTGGTGG - Intergenic
1003105593 6:3212672-3212694 TCCATGCTGCAGTGCAGGGAGGG + Intergenic
1003390735 6:5710573-5710595 CCTAGGCCACAGCACGGGGAGGG + Intronic
1003531275 6:6939607-6939629 CCCAGGCCGGAGTGCAGTGGTGG - Intergenic
1003553279 6:7118161-7118183 CCCAGGCTGGAGTGCAGGGGTGG + Intronic
1003866953 6:10372049-10372071 CCCAGGCTGGAGTGCAGGGGTGG - Intergenic
1004216063 6:13705362-13705384 CCCAGGCCGAAGTGCAGTGGTGG - Intronic
1004305380 6:14497272-14497294 TCCAGGCTGCAGTGCAGGGAGGG - Intergenic
1004457331 6:15803286-15803308 TCCAGGGCTCAGTGTAGGGAGGG + Intergenic
1004515917 6:16322180-16322202 CCCAGGCTGAAGTGCAGTGATGG - Intronic
1004623047 6:17348331-17348353 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1004672762 6:17813448-17813470 CCCAGGCTAGAGTGCAAGGCTGG - Intronic
1005032962 6:21528422-21528444 CCCAGGCTGCAGTGCAGTGGCGG - Intergenic
1006026336 6:31149478-31149500 CCCAGGCTAGAGTGCAGTGATGG + Intronic
1006045010 6:31287840-31287862 CCCAGGGGCCAGTGGAGGGAGGG + Intronic
1006142889 6:31941542-31941564 CCCAGGCTGCAGTGCAGTGGCGG + Intronic
1006466447 6:34197446-34197468 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1006599798 6:35217764-35217786 TCCAGGCCACACTGGAGAGAGGG + Intronic
1006930129 6:37682581-37682603 CTCAGGCCACACAGCAGAGAGGG - Intronic
1007232993 6:40362968-40362990 TCCAGGCCTCAGTGCAGAAAAGG + Intergenic
1007889636 6:45274831-45274853 CCCAGGCCACAGTGCATGTTTGG - Intronic
1007910806 6:45512434-45512456 CCCCGACCCCTGTGCAGGGATGG - Intronic
1008711136 6:54228479-54228501 CCCAGGCAGCTGGGCAGGGAGGG - Intronic
1008773980 6:55012069-55012091 TCCAGGCCACAGTGCAGAACAGG - Intergenic
1008787927 6:55192544-55192566 CCCAGGCTGCAGTGCAGTGGTGG - Intronic
1009187084 6:60587190-60587212 CCCTGGTCACAGTCCTGGGATGG + Intergenic
1009386707 6:63093287-63093309 GCCAGGACATAGTGAAGGGAGGG - Intergenic
1010086305 6:71922495-71922517 TCCAGGCTGCAGTGCAGTGATGG - Intronic
1011555088 6:88565419-88565441 CCCAGCACACAGTGCAGTGAGGG - Intergenic
1011796204 6:90955407-90955429 CTGAGGCCACAGAGCAGTGATGG - Intergenic
1012486395 6:99726072-99726094 CCCACGCCACTGCTCAGGGAGGG + Intergenic
1012620875 6:101341907-101341929 TCCAGGTCACACTGCAGAGAGGG - Intergenic
1013286566 6:108687072-108687094 CCCAGGGCACACTGTAGGAATGG + Intergenic
1013302712 6:108819107-108819129 CCCAGGATAGAGTGCAGTGATGG - Intergenic
1013549809 6:111196293-111196315 CCCAGGCTGCAGTGCAGTGGTGG - Intronic
1014417399 6:121198706-121198728 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
1015590978 6:134822964-134822986 TCCAGGCCTCATTCCAGGGAGGG + Intergenic
1016441051 6:144083981-144084003 CCCAGGCTAAAGTGCAGTGGTGG + Intergenic
1016448733 6:144158979-144159001 GTCTGGCCACAGGGCAGGGAAGG - Intronic
1016897408 6:149066885-149066907 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1016937980 6:149462329-149462351 CCCAGGCCGGAGTGCAGTGGTGG - Intronic
1017344668 6:153367223-153367245 TCCAGACCACAGGGCAGGAACGG - Intergenic
1017848658 6:158283094-158283116 CCCAGGCTGCAGTGCAGTGGTGG - Intronic
1018025352 6:159801049-159801071 CGGAGGCCATAGTGCCGGGATGG + Intronic
1018282963 6:162207327-162207349 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1018512303 6:164538274-164538296 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1019009015 6:168826278-168826300 CCGTGGCCAGAGCGCAGGGAGGG + Intergenic
1019088099 6:169500869-169500891 CCCAGGGCCCCGTGCAGGGCAGG + Intronic
1019145509 6:169973150-169973172 CCCATGTCACTGTGCAGGGTGGG + Intergenic
1019145515 6:169973177-169973199 CCCATGTCACTGTGCAGGGTGGG + Intergenic
1019145527 6:169973231-169973253 CCCATGTCACTGTGCAGGGTGGG + Intergenic
1019145539 6:169973285-169973307 CCCATGTCACTGTGCAGGGTGGG + Intergenic
1019145564 6:169973393-169973415 CCCATGTCACTGTGCAGGGTGGG + Intergenic
1019145576 6:169973446-169973468 CCCATGTCACTGTGCAGGGTGGG + Intergenic
1019145593 6:169973527-169973549 CCCATGTCACTGTGCAGGGTGGG + Intergenic
1019145648 6:169973766-169973788 CCCATGTCACTGTGCAGGGTGGG + Intergenic
1019158034 6:170051967-170051989 CGGAGGTCACAGTGCAGGAAGGG - Intergenic
1019230252 6:170554503-170554525 CCCAGGCCTCAGTGCAGTGGTGG - Intronic
1019415472 7:924810-924832 CCCAGGCCACAGAGCAGCTGGGG + Intronic
1019495711 7:1339488-1339510 TTCAGGCCATGGTGCAGGGAGGG - Intergenic
1019652596 7:2168518-2168540 CCCAGGCCACACAGCAGGCCAGG - Intronic
1019686525 7:2384906-2384928 GCAGGGCCACAGAGCAGGGAGGG + Intergenic
1020059256 7:5140252-5140274 CCCATGCCACAGCCCTGGGACGG - Intergenic
1020168703 7:5827877-5827899 CCCATGCCACAGCCCTGGGATGG + Intergenic
1020215092 7:6184101-6184123 CCCAGGCTGGAGTGCAGGGGCGG + Intronic
1020216262 7:6193127-6193149 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1020222355 7:6249456-6249478 CCGAAGCCACTGTGCTGGGAGGG - Intronic
1020444132 7:8250604-8250626 CCCAGGCTGGAGTGCAGTGAGGG - Intronic
1020471456 7:8540485-8540507 TCCAGGCCACTGTGCAGGGAAGG + Intronic
1020585778 7:10064745-10064767 TCCAGGTCATAGTGCAGGGATGG + Intergenic
1020751963 7:12152706-12152728 TCCAGACCACAGCACAGGGAAGG - Intergenic
1021461445 7:20891796-20891818 CCCAGGCTGCAGTGCAGTGGAGG + Intergenic
1021495224 7:21267021-21267043 CCCAGGCCGGAGTGCAGTGGTGG + Intergenic
1021802781 7:24324598-24324620 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1022000883 7:26224916-26224938 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1022402737 7:30055983-30056005 CCCAGGCTGCAGTGCAGTGGCGG + Intronic
1022706451 7:32806308-32806330 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1023222941 7:37939019-37939041 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1023449635 7:40269363-40269385 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1023824237 7:43997928-43997950 CCCAGGACTTTGTGCAGGGAGGG + Intergenic
1024277519 7:47690266-47690288 TCCAGGCTAGAGTGCAGTGATGG - Intergenic
1024294025 7:47828522-47828544 CCCAGGCTACACTGCAGTAAAGG - Intronic
1024612378 7:51078702-51078724 ACCAGGCTACAGTGCAGGTGTGG + Intronic
1024626757 7:51214224-51214246 CCCAGGCTACAGTGCAGTGGCGG - Intronic
1026337003 7:69402952-69402974 CCCAGGCTGCAGTGCAGTGGTGG - Intergenic
1026463390 7:70633566-70633588 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1026812716 7:73481994-73482016 CCCAGGCCAGAGTGCAGTGGCGG - Intronic
1026845220 7:73694991-73695013 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1027186118 7:75971817-75971839 CTGAGGCCACCATGCAGGGAGGG + Intronic
1027327860 7:77062505-77062527 CCCAGGACTTTGTGCAGGGAGGG - Intergenic
1027474513 7:78612710-78612732 CCCAGGCCGGAGTGCAGTGGAGG + Intronic
1028016449 7:85719680-85719702 CCCAGTCTACAGTGCAGTGGCGG - Intergenic
1028125881 7:87113059-87113081 TCCAGCCCACACTGAAGGGAGGG - Intergenic
1028250022 7:88529735-88529757 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1028770535 7:94615314-94615336 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1029187753 7:98751896-98751918 CCCAGGCAACAGCCCAGGGCAGG + Intergenic
1029261155 7:99303757-99303779 CCCAGGCTGCAGTGCAGTGGCGG - Intergenic
1029503333 7:100947496-100947518 CCTAGGCCAGAGTGCAGTGGCGG + Intergenic
1029752502 7:102551257-102551279 CCCAGGACTTTGTGCAGGGAGGG + Exonic
1029770454 7:102650350-102650372 CCCAGGACTTTGTGCAGGGAGGG + Exonic
1030027621 7:105340441-105340463 CCCAGGCTGCAGTGCAGTGGTGG + Intronic
1030043950 7:105477844-105477866 TCTAGGCCACAGTGCAGTGGTGG + Intronic
1030153064 7:106425641-106425663 CCCAGGCCTGGCTGCAGGGAGGG + Intergenic
1030223749 7:107126043-107126065 CCCAGGCTAAAGTGCAGTGGTGG - Intronic
1030514274 7:110520453-110520475 CCCAGGCCACAGTGTTGGGAGGG - Intergenic
1030652377 7:112129360-112129382 GCCAGGGAACAGTGGAGGGATGG + Intronic
1030793246 7:113755896-113755918 CCCAGCCTACAGTGCAGTGGCGG + Intergenic
1030819886 7:114083369-114083391 CCCTGGCCACACTGCAGACACGG - Intergenic
1031052655 7:116960230-116960252 CCCAGGCTGGAGTGCAGGGACGG + Intronic
1031195794 7:118611393-118611415 TCCAGACCACAGCACAGGGAAGG - Intergenic
1032084940 7:128878979-128879001 CCTGGGGCCCAGTGCAGGGATGG - Intronic
1032086051 7:128884530-128884552 CCCTGGCTGCAGTGCAGGGCGGG - Intronic
1032105190 7:129022418-129022440 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1032120412 7:129151167-129151189 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1032362314 7:131267287-131267309 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1032511494 7:132476002-132476024 CCCAGGCTTGAGTGCAGAGAAGG + Intronic
1032991705 7:137401478-137401500 CCCAGGCTAGAGTGCAGTCATGG - Intronic
1033044183 7:137946167-137946189 CACAGGCCACACTCAAGGGAAGG - Intronic
1033117568 7:138639210-138639232 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1033458219 7:141521586-141521608 CCCAGTCCACATTCAAGGGAAGG + Intergenic
1034110295 7:148530492-148530514 CCCAGGCTGGAGTGCAGGGACGG - Intergenic
1034124303 7:148657141-148657163 CCCAGGCTGGAGTGCAGTGAAGG - Intergenic
1034260352 7:149751513-149751535 CCCAGCCCGCTGAGCAGGGAGGG + Intergenic
1034284724 7:149877230-149877252 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1034347722 7:150397493-150397515 CCGCGGCCACAGTGCGGGCAGGG - Exonic
1034495253 7:151417036-151417058 TCCAGACCACAGAGCAGGAACGG + Intergenic
1035024834 7:155818652-155818674 CCAAGGCCCCAGGGCAGGAACGG - Intergenic
1035034723 7:155887250-155887272 CCCAGCCCACAGTGCAGCCATGG - Intergenic
1035040147 7:155921169-155921191 CCCTGGGCTCAGAGCAGGGAGGG + Intergenic
1035610733 8:962452-962474 CCACGGCCACAGTGCAAGGACGG - Intergenic
1035640812 8:1183665-1183687 CCCAGGAGACAGGGCAGAGAAGG + Intergenic
1035676317 8:1458832-1458854 CCCAGGACAGAGAGCAGGGTCGG + Intergenic
1035725181 8:1820171-1820193 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1035860638 8:3024346-3024368 CCCAGGCTAGATTGCAGTGATGG + Intronic
1036012354 8:4740708-4740730 CCCATGCTAGAGTGCAGAGATGG - Intronic
1036665898 8:10738135-10738157 TCCAGGCCATGATGCAGGGAAGG + Intronic
1036692159 8:10950948-10950970 CCAAGGCCACACAGCAAGGATGG + Intronic
1036944066 8:13078276-13078298 CCCAGGCCAAAGTGCAGTGGTGG + Intergenic
1037247702 8:16855332-16855354 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1037523596 8:19703344-19703366 CCCAGGCTAGAGTGCAGCGGCGG + Intronic
1037825059 8:22155936-22155958 CCCATGCCAGGGTGCTGGGAGGG + Intronic
1037963998 8:23119258-23119280 TCCAGGCTACAGCACAGGGAGGG - Intergenic
1037976756 8:23219343-23219365 TCCAGGCTACAGCACAGGGATGG + Intronic
1038574718 8:28695170-28695192 CTCAGGCTACAGTGCAGTGGCGG + Intronic
1038645150 8:29354827-29354849 CCCAGGCTGGAGTGCAGTGAGGG - Intergenic
1038646632 8:29367285-29367307 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1039514491 8:38120455-38120477 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1039956904 8:42214752-42214774 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1040058309 8:43081605-43081627 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1040517167 8:48144561-48144583 CCAAGGCCACAGGGCCGGGGTGG + Intergenic
1041065505 8:54079026-54079048 TCCAGGCTGGAGTGCAGGGATGG + Intronic
1041324720 8:56652204-56652226 CCAGGGCCACAGTGCATGCATGG + Intergenic
1041572270 8:59351104-59351126 CCCAGGCTGGAGTGCAGGGGTGG - Intergenic
1041800986 8:61798617-61798639 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1042134653 8:65621549-65621571 CCCAGGCTAGAGTGCAGTGGTGG + Intronic
1042217627 8:66441927-66441949 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1042670925 8:71262548-71262570 CCAAGGCCACAGAGCAAGGGAGG + Intronic
1043608382 8:82030827-82030849 CCCAGGGCAGAGTGCAGTGGTGG + Intergenic
1043815065 8:84792047-84792069 CCCAGGCCAGCATCCAGGGAAGG + Intronic
1043849290 8:85197840-85197862 CCCAGGCAACTGTCCAGGGCTGG + Intronic
1043921042 8:85983603-85983625 CTCACTGCACAGTGCAGGGAGGG + Intergenic
1044583637 8:93848159-93848181 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1044732242 8:95238707-95238729 CCCAGGCTGCAGGGCAGGGAGGG - Intergenic
1044820604 8:96153523-96153545 ACCGGTCGACAGTGCAGGGAAGG - Intronic
1045261422 8:100578158-100578180 CCCAGGGCACAGAGCAGAGTGGG + Intronic
1045384435 8:101657795-101657817 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
1045523376 8:102922390-102922412 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1045715153 8:105034695-105034717 TCCAGGCTGCACTGCAGGGAGGG + Intronic
1046588267 8:116174641-116174663 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1046647229 8:116799394-116799416 TCCAGGCTACAGAGCATGGAAGG - Intronic
1047228598 8:122977054-122977076 CTCAGGCAACAGTCCAGGGTGGG + Intergenic
1047423746 8:124727771-124727793 CGGTGGCCACACTGCAGGGAAGG + Intronic
1047484712 8:125318812-125318834 TTCAGGCCATAGTACAGGGAAGG + Intronic
1047602330 8:126438097-126438119 CCCAGGCTAGAGTGCAGTGATGG - Intergenic
1047617374 8:126573830-126573852 CCCAGGCTACAGTGCAGTGGCGG + Intergenic
1047705752 8:127497860-127497882 AGCAGCCCACAGTTCAGGGATGG + Intergenic
1047959311 8:129999339-129999361 CCCTGTCCACAGGGAAGGGAAGG + Intronic
1048043670 8:130753869-130753891 TCCAATCCACAGTGCAGGAAGGG - Intergenic
1049023254 8:139971870-139971892 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1049096253 8:140550036-140550058 TCCAGGCCAAAGTGAAGGAAGGG + Intronic
1049216036 8:141408833-141408855 CCCAGGGCTCAGGGCAGGGCAGG + Intronic
1049425337 8:142535598-142535620 CCCAGGCCACAGGGCCGGCTGGG - Intronic
1049747687 8:144269939-144269961 CCCAGTGCCCAGTGGAGGGAGGG - Intronic
1049819919 8:144627242-144627264 TCCAGGCCACAATGCAAGAAAGG + Intergenic
1049949501 9:630506-630528 CCCAGGCTGCAGTGCAGTGGCGG - Intronic
1049998492 9:1052164-1052186 CTCAGGCCACAGTGGAGGTGGGG + Intronic
1050545540 9:6705699-6705721 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1050575241 9:6988110-6988132 CCCAGGCTAGAGTGCAGTGGTGG - Intronic
1050978790 9:11980469-11980491 CCCAGGCTGGAGTGCAGGGGCGG + Intergenic
1051602544 9:18889674-18889696 CCCTGCCCACTGCGCAGGGAAGG + Exonic
1051743621 9:20274820-20274842 CTCATCCCACAGTGCAGAGAGGG - Intergenic
1052856221 9:33408219-33408241 CCCAGGGACCAGTGCAGGCATGG - Intergenic
1052927929 9:34032871-34032893 CCCAGGCCAGAGTACAGTGGCGG - Intronic
1053297268 9:36923796-36923818 CACACTCCTCAGTGCAGGGATGG + Intronic
1053454922 9:38226708-38226730 CAGAAGCCAAAGTGCAGGGATGG + Intergenic
1053465486 9:38304590-38304612 CCCAGGCTGGAGTGCAGGGCTGG + Intergenic
1053600566 9:39604496-39604518 CCCAGGGCGCTGTGCAGGGCCGG + Intergenic
1053706985 9:40766479-40766501 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1053858214 9:42358351-42358373 CCCAGGGCGCTGTGCAGGGCCGG + Intergenic
1054252963 9:62737888-62737910 CCCAGGGCGCTGTGCAGGGCCGG - Intergenic
1054416899 9:64887247-64887269 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1054567080 9:66772387-66772409 CCCAGGGCGCTGTGCAGGGCCGG - Intergenic
1055017459 9:71634178-71634200 CCCAGGCCGGAGTGCAGTGGCGG + Intergenic
1055101706 9:72472293-72472315 CCCAGGCCACAGGGCAGATTAGG + Intergenic
1055110728 9:72556776-72556798 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
1055355688 9:75434984-75435006 AGGAGGCTACAGTGCAGGGATGG - Intergenic
1055381344 9:75710229-75710251 TCCAGGCCACAGTACAGCAACGG - Intergenic
1055544732 9:77357996-77358018 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1055768974 9:79695666-79695688 CCACAGCCACAGTGCTGGGAAGG + Intronic
1056664470 9:88570783-88570805 CCCAGGCCAGAGTGCAGTGGCGG + Intronic
1056774958 9:89504995-89505017 CCCAGGCTAGAGTGCAGTGGCGG - Intergenic
1056967435 9:91177031-91177053 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1057207363 9:93181647-93181669 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1057211553 9:93203466-93203488 CCCTGGCCACAGAGCAGGTTGGG + Intronic
1057216249 9:93230429-93230451 CCCAGGGCACAGCTCAGGGCAGG + Intronic
1057325313 9:94058081-94058103 TCCAGGCTTCAGTGCAGGGAGGG + Intronic
1057626929 9:96686410-96686432 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1057861455 9:98644079-98644101 TCCAGGTGACAGTGCAGTGAGGG - Intronic
1058457067 9:105147579-105147601 CCAAGGGCAGAGGGCAGGGAAGG - Intergenic
1058540930 9:106011812-106011834 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1058845382 9:108952720-108952742 CAGAGGCCACAGAGCAGGGAAGG - Intronic
1058946002 9:109856978-109857000 CGCAGGCCACAGAACAGGGGAGG - Intronic
1059125716 9:111682950-111682972 CCCAGGCTGCAGTGCAGTGGCGG + Intergenic
1059560941 9:115333865-115333887 CCCTGGGCACAGTCCAGGAATGG - Intronic
1059638367 9:116192204-116192226 CCAAGGACACAGAGCAGGGTGGG + Intronic
1060016068 9:120087572-120087594 CCAAGGCCACAGAGCCAGGAGGG - Intergenic
1060054869 9:120404605-120404627 CCAAGGCCCGGGTGCAGGGAAGG + Intronic
1060413706 9:123416208-123416230 CCCAGCCCACAGCCCAGGGCTGG + Intronic
1060634893 9:125192230-125192252 CCCAGGCTAGAGTGCAGTGGTGG - Intergenic
1060684759 9:125598987-125599009 CCCAGGCTAGAGTGCAGTGCTGG - Intronic
1060984306 9:127810749-127810771 CTCAGGCCACAGGCCAGGCAGGG + Intronic
1061015114 9:127976978-127977000 CCCAGGCTGCAGTCCAGGGTGGG + Intronic
1061085923 9:128398323-128398345 CCCAGGCCAGAGTGCACTGGTGG - Intergenic
1061117682 9:128624933-128624955 GCCAGGCCTGGGTGCAGGGAGGG + Intronic
1061119365 9:128633825-128633847 CCCAGGGCACAGTGAAGGTGTGG - Exonic
1061314992 9:129789669-129789691 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1061422555 9:130480127-130480149 CCCAGGACACAGGGAACGGAAGG + Intronic
1061428605 9:130516966-130516988 CCCAGGCTAGAGTGCAGTGGCGG - Intergenic
1061497751 9:130985319-130985341 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1061534681 9:131240154-131240176 TCCAGATCACAGTGCATGGAAGG + Intergenic
1061775169 9:132958158-132958180 GCCAGGCCAGAAGGCAGGGAGGG + Intronic
1061818280 9:133208791-133208813 CCCAGCCCCCAGTGGAAGGAGGG + Intronic
1061895494 9:133644748-133644770 GCCTGGCCAGAGTGCAGGGACGG + Intronic
1062023962 9:134332015-134332037 CCCAGGGCACAGAGCTGGCATGG - Intronic
1062026282 9:134342212-134342234 CCCAGGCCAGAGTGAGGGCAGGG + Intronic
1062065213 9:134523084-134523106 CCCTGGCCACGCTGCAGAGAGGG - Intergenic
1062110174 9:134777834-134777856 CCCAGGACTCAGGGCAGGGAGGG + Intronic
1062131397 9:134895868-134895890 CCCAGGTCATAGTCCAGGGCAGG - Intergenic
1062232463 9:135489477-135489499 ACCACGCCACAGTGCAGGAGAGG - Intergenic
1062242172 9:135546567-135546589 CCCAGCCCCCAGTGGAAGGAGGG - Intronic
1062250059 9:135589360-135589382 CCATGGGCCCAGTGCAGGGATGG - Intergenic
1062310870 9:135936136-135936158 CCCAGGCTAGAGTGCAGTGATGG - Intronic
1062476235 9:136728744-136728766 CCCAGGACACAGCGCAGACAGGG - Intergenic
1062578080 9:137217797-137217819 CCCAGGGCACAGTTCAGGGGTGG - Intergenic
1062627174 9:137448548-137448570 CCCAGGCCTGTGTGCTGGGATGG + Exonic
1062633831 9:137479420-137479442 CCCAGCACACAGTGGACGGATGG - Intronic
1203490668 Un_GL000224v1:102116-102138 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1203503292 Un_KI270741v1:43995-44017 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1185706022 X:2266801-2266823 CCCTGGCCACAGTGCGAGGGTGG - Exonic
1185750269 X:2605264-2605286 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1185760568 X:2687418-2687440 CCCTGGCCACAGTCCTGGGCTGG - Intergenic
1185834856 X:3335938-3335960 CCCAGGCCACAGAGCAGTACCGG + Intronic
1186542303 X:10413047-10413069 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1187342139 X:18430902-18430924 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1187499602 X:19828739-19828761 CCCAGGCTGGAGTGCAGGGGTGG - Intronic
1187735023 X:22294386-22294408 CCTAGGCCTCTGTGCAGGGCAGG + Intergenic
1187757705 X:22545585-22545607 CCAGGGCCACAGTGCATGGGGGG - Intergenic
1187903748 X:24048334-24048356 CCCAGGTCAGAGTGCAGTGGTGG + Intergenic
1187923650 X:24230381-24230403 TCCAGGTCACGGTGCGGGGAAGG - Intergenic
1188437645 X:30180214-30180236 TCATGGACACAGTGCAGGGAAGG + Intergenic
1189502314 X:41574272-41574294 TCCAGGCCACAGCACAGGGAGGG - Intronic
1189770401 X:44419685-44419707 CCCAGGCTGCAGTGCAGTGGCGG - Intergenic
1189902090 X:45717057-45717079 TCCAGGTCATAGTGCAGGGACGG + Intergenic
1190258162 X:48780188-48780210 CCCAGGCTGCAGTGCAGTGGGGG - Intergenic
1190521568 X:51283799-51283821 CCCAGGCTGCAGTGCAGTGGCGG + Intergenic
1190594830 X:52042067-52042089 CCCAGGCCACAGAGGAGAAAAGG + Intergenic
1190613994 X:52212006-52212028 CCCAGGCCACAGAGGAGAAAAGG - Intergenic
1190819555 X:53960704-53960726 CCCAGGCTAGAGTGCAGTGGCGG - Intronic
1190864864 X:54375850-54375872 TACAGGCCACAGTGCAGATAGGG + Intergenic
1191797300 X:65034886-65034908 CCCTGGCCACAGAGCAGCGGCGG - Intergenic
1192237378 X:69304550-69304572 CCCAGGCTGGAGTGCAGGGGTGG - Intergenic
1192447279 X:71220547-71220569 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1192512846 X:71735627-71735649 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1192513851 X:71745882-71745904 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1193482345 X:82043487-82043509 CCCAGGCTGCAGTGCAGTGGTGG - Intergenic
1194222023 X:91205819-91205841 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1194711944 X:97245943-97245965 CCCAGGCTAGAGTGCAGTGGCGG + Intronic
1194885641 X:99313148-99313170 TCCAGGCTGCAGTGCAGGAAAGG + Intergenic
1195067985 X:101254700-101254722 CTCAGGCCAGAGTGCAGGTCAGG - Intronic
1195298700 X:103505969-103505991 CACAGGTGACAGTGCAGTGAAGG - Intronic
1195317482 X:103693191-103693213 CCCAGGCTAGAGTGCAGTGGCGG + Intergenic
1196038761 X:111177339-111177361 CCCAGGCCTGAATGCTGGGATGG - Intronic
1196298709 X:114029858-114029880 CCCAGGCTGCAGTGCAGTGGTGG - Intergenic
1196674797 X:118408438-118408460 CCCAGGCTGGAGTGCAGGGGCGG + Intronic
1196679599 X:118457156-118457178 CCCAGGCTGGAGTGCAGGGGTGG - Intergenic
1198319570 X:135506431-135506453 CCCAGGCTAGAGTGCAGTGATGG + Intergenic
1199168752 X:144709931-144709953 TCCAGGCCACAGTACTGAGAGGG - Intergenic
1199841158 X:151650818-151650840 TCTAGGCCACATTGCAGAGAGGG + Intronic
1199916165 X:152343212-152343234 TTTAGGCTACAGTGCAGGGAGGG - Intronic
1199991614 X:152990483-152990505 CTCAGGCCACCGTGCAGGCAAGG - Exonic
1200042424 X:153379788-153379810 CCCAGGCAAGAATGCAGGGCCGG + Intergenic
1200059823 X:153479282-153479304 CCCCGCCCACAGTGCCAGGATGG - Intronic
1200061869 X:153487389-153487411 CCCAGGCCTCAGTGCAGGTGTGG - Intronic
1200142626 X:153909570-153909592 CCCTGGACCCCGTGCAGGGAAGG - Intronic
1200224733 X:154411323-154411345 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1200544086 Y:4497800-4497822 CTCAGGCCACGGGGCAGAGAGGG - Intergenic
1200558542 Y:4669595-4669617 CCCAGGCTAGAGTGCAGTGGTGG + Intergenic
1200773690 Y:7150874-7150896 CCCAGGCTAGAGTGCAGTGTTGG + Intergenic
1201062473 Y:10059543-10059565 AGCAGGCCTCAGGGCAGGGAAGG - Intergenic
1201190832 Y:11440847-11440869 GCCAGGCCACAGAGATGGGAGGG - Intergenic
1201273880 Y:12281289-12281311 CCCAGGCCAGACTGCAGTGGTGG - Intergenic
1201372085 Y:13276677-13276699 CCCAGGCTGGAGTGCAGTGACGG - Intronic
1202111661 Y:21427550-21427572 AGCAGGCCTCAGGGCAGGGAAGG - Intergenic
1202254007 Y:22901953-22901975 TGCAGCCCACAGAGCAGGGAGGG - Intergenic
1202406997 Y:24535702-24535724 TGCAGCCCACAGAGCAGGGAGGG - Intergenic
1202463784 Y:25134379-25134401 TGCAGCCCACAGAGCAGGGAGGG + Intergenic