ID: 1062776087

View in Genome Browser
Species Human (GRCh38)
Location 10:149235-149257
Sequence AATTCCCAGGCCACAGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 10, 3: 46, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062776087_1062776092 2 Left 1062776087 10:149235-149257 CCCTGCACTGTGGCCTGGGAATT 0: 1
1: 0
2: 10
3: 46
4: 335
Right 1062776092 10:149260-149282 TGTGAGGCAGAACACTGAGGTGG No data
1062776087_1062776091 -1 Left 1062776087 10:149235-149257 CCCTGCACTGTGGCCTGGGAATT 0: 1
1: 0
2: 10
3: 46
4: 335
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062776087 Original CRISPR AATTCCCAGGCCACAGTGCA GGG (reversed) Intronic
902510630 1:16965268-16965290 TGTTCCCAGGGCCCAGTGCAAGG - Intronic
903267995 1:22169984-22170006 ATTTCCCTGGCCACAGTGATTGG + Intergenic
903404258 1:23083221-23083243 AACTACCCAGCCACAGTGCATGG + Exonic
904287961 1:29465329-29465351 AATTTCCAGGCCATGGTGTAGGG - Intergenic
904815850 1:33197637-33197659 AGTTTCCAGGCCACAGTACGGGG + Intergenic
905069552 1:35213356-35213378 AATACCCAGGCCACAGAAAATGG + Intergenic
905242140 1:36588252-36588274 AAATCCCAGGCCCCAGCTCAGGG + Intergenic
905849813 1:41265327-41265349 AATTCCTAGGCCACTGGGCCGGG - Intergenic
906316766 1:44791535-44791557 AATTCACAGACCACAGGGCTGGG - Intergenic
906432961 1:45770563-45770585 AATTTCCTGGCCACAGTTCAAGG + Intergenic
907301197 1:53487234-53487256 AATTCCCAGGCCACAAAGCAGGG - Intergenic
909534519 1:76721368-76721390 ACTTTCCAGGCCTCAGTGCAGGG + Intergenic
910254919 1:85238271-85238293 AATTCCCAACCCACTGGGCAAGG - Intergenic
912297331 1:108482887-108482909 AATTCCCAGTCCAAGGTCCAAGG - Intergenic
912595776 1:110874363-110874385 AATTCCCAAAGCACAGTGCCTGG - Intronic
912705749 1:111910678-111910700 ATTGCCCAGGCCACACTGCCTGG + Intronic
913202747 1:116509191-116509213 AAGTCATAGTCCACAGTGCAAGG - Intergenic
913550209 1:119910156-119910178 CATTCCCTGGCCCCAGTCCATGG - Intergenic
915271587 1:154757569-154757591 AATTCCCAGGCCATTATGCCTGG + Intronic
915744597 1:158146244-158146266 CATTCCCAGGCCAGAGAGCTTGG - Intergenic
916501386 1:165390340-165390362 ATGTCCAAGTCCACAGTGCAGGG - Intergenic
916534029 1:165686271-165686293 AGTTTTCAGGCCACAGAGCAGGG + Intronic
916856497 1:168755861-168755883 AATGCCGAGGCCCCAGTGCCAGG + Intergenic
916891169 1:169113851-169113873 AATTACCAGGCCAAAGAACAAGG - Intronic
917638959 1:176963852-176963874 AATGCCCATGTCACAGTCCAAGG + Intronic
919792574 1:201301546-201301568 AATTCCCTGGCCACAGAGAATGG + Intronic
920431851 1:205923826-205923848 AGCTCCCAGACCACAGGGCAGGG + Intronic
921784676 1:219215709-219215731 GAGTCCCAGTCCACAGTACAGGG - Intergenic
922018335 1:221675975-221675997 ATTTCCCAGGTCACTGGGCAGGG + Intergenic
924217625 1:241840396-241840418 AAGTCCCAGGTCAAGGTGCAGGG + Intergenic
1062776087 10:149235-149257 AATTCCCAGGCCACAGTGCAGGG - Intronic
1063718101 10:8549628-8549650 AGTTTGCAGGCCACAGTGGAGGG - Intergenic
1063947205 10:11189642-11189664 AGTTTCCAGGCCACAGCACAGGG - Intronic
1064624566 10:17248933-17248955 ATTGCCCAGGCTAGAGTGCAGGG - Intergenic
1065270447 10:24027245-24027267 AGTTTCCAGGTCATAGTGCAGGG - Intronic
1065577181 10:27132994-27133016 AATTCTCAGGCCACAGCACAGGG + Intronic
1066138345 10:32475253-32475275 AATTGCCAGTCCACAGTGTAGGG - Intronic
1070035599 10:72720118-72720140 TAATCCCAGGCCATAGTGGAAGG - Intronic
1070702774 10:78615584-78615606 AATTCCCAGGCCAAGGGGGAAGG + Intergenic
1071252163 10:83830085-83830107 AGTTTCTAGGCCACAATGCAAGG + Intergenic
1072194896 10:93109092-93109114 AGTTTCCAGGCCACAGCACATGG - Intergenic
1072768498 10:98116232-98116254 AATTCCCAGGCCTCCCTGAAAGG + Intergenic
1073063044 10:100743645-100743667 AGCTCCCAGGCCAGAGTGCAAGG - Intronic
1074308529 10:112301031-112301053 AATTCCCAGGCCACAAAACCAGG - Intronic
1075064459 10:119280096-119280118 AACTCCCTGGGCACAGAGCAGGG - Intronic
1076314586 10:129531564-129531586 AAGCCCCAGGCCACCGAGCACGG - Intronic
1077261754 11:1625621-1625643 AACCCTCAGGCCACAGTCCATGG + Intergenic
1077443298 11:2578624-2578646 CATTCCCAGGTCACTGTGCTGGG - Intronic
1077657772 11:4038484-4038506 AATTTCCAAGCCACAGTGCAAGG - Intronic
1077837948 11:5940847-5940869 AGTTTCCAGGCTGCAGTGCAGGG + Intergenic
1078031484 11:7755929-7755951 GTCACCCAGGCCACAGTGCAGGG - Intergenic
1078446896 11:11411347-11411369 AATCCCCAGGACAGAGGGCAAGG + Intronic
1078862845 11:15268059-15268081 TGTTTCCAGGCTACAGTGCAAGG - Intergenic
1078960681 11:16264994-16265016 AGTTTCCAGGCTACAGTACAAGG + Intronic
1079732106 11:23946334-23946356 ATTTCCCAGGCCCTTGTGCAAGG - Intergenic
1081015624 11:37875994-37876016 AGTTTCCAGGCCACAGTGTGTGG - Intergenic
1084579641 11:70015217-70015239 AATCCCCAAGCCACAGAGAAAGG + Intergenic
1084664615 11:70569667-70569689 GTTTCCCAGGCCACAGTGATTGG + Intronic
1084693128 11:70738509-70738531 CATTCCCAGGGCCCATTGCAGGG + Intronic
1084862724 11:72031262-72031284 GTTGCCCAGGCCACAGTGCAGGG - Intronic
1085012606 11:73151832-73151854 GCCTCCCAGGGCACAGTGCAGGG - Intergenic
1087142029 11:94773944-94773966 AATTCCGAGGTCACACAGCAAGG - Intronic
1087834472 11:102858775-102858797 AATTTCCAGGACACAGCACAGGG - Intergenic
1089133540 11:116231262-116231284 AACCCCCAGGCCAGAGTCCATGG - Intergenic
1089281428 11:117377362-117377384 AACCCCCAGGCCACAGAGCAGGG - Intronic
1089687214 11:120160975-120160997 AGTTTCCAGGTCACAGAGCAGGG - Intronic
1090126187 11:124087348-124087370 TATTCCCAGGACCCAGTACATGG + Intergenic
1090428618 11:126627796-126627818 AACTCACAGGCCCCAGTGGAGGG + Intronic
1090428893 11:126629582-126629604 GATTCCCAGGGCACAGGGCAGGG - Intronic
1091038827 11:132257537-132257559 AGTTCCCAGGCCACACTGCAGGG - Intronic
1092261315 12:6954756-6954778 AAGACCCAGGCCACAGGGGAAGG - Intronic
1092274452 12:7048585-7048607 AATTCCCAAGCCACATTCAAGGG + Intronic
1093343671 12:18012702-18012724 AGATTCCAGGCCACAGTACATGG - Intergenic
1093794765 12:23298123-23298145 AGTTTCCAGGCCATGGTGCAGGG - Intergenic
1093902265 12:24649518-24649540 TATTCCCAGGGCACAGAGAAAGG + Intergenic
1094830517 12:34298056-34298078 TATCCCCAGGGCCCAGTGCAGGG - Intergenic
1094837018 12:34326843-34326865 GATCCCCAGGACACAGCGCAGGG + Intergenic
1095137492 12:38623329-38623351 AATTCCAAGGCCAAAGAGAATGG - Intergenic
1095476739 12:42593340-42593362 ATTGCCCAGGCTAGAGTGCAGGG - Intergenic
1095986623 12:48003664-48003686 AAATCCCAGGCCACAAAGAACGG - Intronic
1096543315 12:52320827-52320849 AGTTCCCAGGCCAAAGGGAAAGG - Intronic
1096547345 12:52349594-52349616 TATTCAAAGGCCACTGTGCAGGG - Intergenic
1096776481 12:53967360-53967382 AACTCCCAGGCCTCAGTGCCTGG + Intergenic
1098234158 12:68402322-68402344 CATTCCCTGGTCACAGTTCAGGG + Intergenic
1100641169 12:96483704-96483726 AATTCTGAGGCCAAAGAGCATGG - Intergenic
1100773703 12:97951624-97951646 AAGTCCCAGGCATCAGTGAAAGG + Intergenic
1100886035 12:99071228-99071250 ATGTCCCAAGACACAGTGCAAGG - Intronic
1101252556 12:102950487-102950509 CATTCCCAGGCCGCACCGCAAGG + Intronic
1102027246 12:109720481-109720503 AATCCCCAGGCCTGAATGCAGGG + Intronic
1102036036 12:109770993-109771015 AATCCCCAGGCACCAGAGCAGGG - Intergenic
1103001677 12:117389564-117389586 CATTTCCAGGCCACAGAGGAAGG + Intronic
1104250611 12:127089680-127089702 AATTTCCTGGCCCCAGTGAAGGG - Intergenic
1107376951 13:39813830-39813852 AGTTCCCATTCCACAGTTCATGG + Intergenic
1108263521 13:48681452-48681474 TACTACCAGGCCACAGTGCAAGG - Intronic
1109812303 13:67529666-67529688 AATTTCCATTTCACAGTGCATGG - Intergenic
1110040176 13:70744850-70744872 AATTTCCAAACCACAGTGGAGGG - Intergenic
1111932517 13:94526390-94526412 AATTCCAAGGCCAAGGTGAAAGG + Intergenic
1113939250 13:114010079-114010101 AGTTTCCAGCCCACAGCGCAGGG + Intronic
1114773315 14:25453467-25453489 ATTTCCCAGGCCACAGTGATTGG + Intergenic
1115650298 14:35398208-35398230 AATTTCCAGGCCCCAGGGGAAGG + Intergenic
1115938319 14:38580193-38580215 AATTCCCAAGCCATGCTGCAGGG + Intergenic
1116912133 14:50479868-50479890 AGTTTTCAGGCCACAGTACAGGG - Intronic
1118421696 14:65612676-65612698 AGTTTCCAGACCACAGTGTATGG - Intronic
1118898999 14:69971055-69971077 ATTGCCCAGGCTAGAGTGCAGGG + Intronic
1119555094 14:75546925-75546947 AAGTCCCATGGCACAGAGCAAGG + Exonic
1119688360 14:76651332-76651354 AATTCCCATTCCACAGAACATGG + Intergenic
1120124409 14:80723887-80723909 ACTTCCCAGGACACTGTGTAAGG - Intronic
1121633283 14:95437027-95437049 AATTCCCAGGACACATGGCCAGG - Intronic
1121854902 14:97259048-97259070 AGTTTCCTGGCTACAGTGCAGGG + Intergenic
1122369309 14:101220275-101220297 AGTTTCCAGGCCATGGTGCAGGG - Intergenic
1124215709 15:27805866-27805888 GATTCAAAGGCCACAGGGCAGGG + Intronic
1125687045 15:41569726-41569748 GTTGCCCAGGCCAGAGTGCAGGG - Intronic
1126028394 15:44471938-44471960 AATTCCCAGGACACAGCCCCAGG - Intronic
1126313666 15:47344489-47344511 AGTTTCCAGGCCACTATGCAGGG + Intronic
1127271110 15:57402861-57402883 ATTTCCCAGCCCTCAGTGCAGGG + Intronic
1128434982 15:67637781-67637803 AGTTCCCAGGCCTCAGTGCAGGG - Intronic
1128541925 15:68541977-68541999 AGTTTCCAGGCCACGGTGCAGGG - Intergenic
1128635706 15:69301040-69301062 ATTACCCAGGCTAGAGTGCAAGG + Intronic
1129127597 15:73457533-73457555 AGTTTCCAGGTCAGAGTGCAAGG - Intronic
1130838618 15:87676016-87676038 AGTTTCCAGGCCACAGCACAGGG + Intergenic
1131492168 15:92872637-92872659 CATTTCCAGGCCTCAGTGCTGGG - Intergenic
1132114864 15:99128366-99128388 AACCCCCAGGCAATAGTGCAGGG - Intronic
1132922720 16:2407221-2407243 AATGCCCAGGCTGGAGTGCAAGG + Intergenic
1133220444 16:4317163-4317185 GCTTCCCAGGCCCCAGGGCAGGG - Intronic
1133317805 16:4894956-4894978 CATTCCCTGGCCACAGTGATTGG + Intronic
1133610364 16:7427681-7427703 GTTTCCCAGGCTAGAGTGCATGG + Intronic
1134292643 16:12914876-12914898 AGTTCCCAGGCGACACTGCTAGG + Intronic
1134318178 16:13139076-13139098 ATTTCTGAGGCCACAGTGGAAGG - Intronic
1135348245 16:21707472-21707494 AATCCCCCGGCCCCAGTCCACGG - Intronic
1135725665 16:24852301-24852323 AATTTCCACACCCCAGTGCAAGG - Intronic
1136344664 16:29666985-29667007 CCTGCCCAGGCCACAGAGCAGGG - Exonic
1137237534 16:46627799-46627821 ACTACTCAGGGCACAGTGCAGGG + Intergenic
1138946208 16:61853044-61853066 AATTACCATGCTAGAGTGCAAGG - Intronic
1138950780 16:61909896-61909918 AATTCCCAAGCCAGTGTTCATGG + Intronic
1140186513 16:72777757-72777779 AGTTTCCAGGCCACAGCACAGGG + Intergenic
1140418517 16:74796102-74796124 AGTTTCCAGGTCATAGTGCATGG + Intergenic
1140543878 16:75787961-75787983 AGATTCCAGGCCACAGTGCAAGG - Intergenic
1141482785 16:84318086-84318108 AGTGCCCAGCCCACAGTGAAAGG + Intronic
1142154626 16:88527475-88527497 GAGTCCCTGGCCCCAGTGCAGGG + Intronic
1142242125 16:88952359-88952381 AATGCCCAGGCCACAGGGTGAGG + Intronic
1142817931 17:2442338-2442360 AATTCCCAGACTGCAGTACAGGG + Intronic
1143202207 17:5120972-5120994 ATTTTGCAGGCCACAGTGAAGGG - Intronic
1143659878 17:8318334-8318356 AATCCCAGGGCCACAGAGCAGGG + Intronic
1143972352 17:10804750-10804772 AATTCCCAGGCAAAAGTCAAGGG + Intergenic
1144355367 17:14440755-14440777 AATTACCAGGCCAAGGTCCATGG + Intergenic
1144434860 17:15231357-15231379 AATTCCCAGGCCACACTACATGG + Intronic
1144627213 17:16850185-16850207 ATTTTGCAGGCCACAGTGAAGGG + Intergenic
1144668294 17:17116822-17116844 GTTTCCCAGGCCACATTCCAGGG - Intronic
1144879226 17:18422527-18422549 ATTTTGCAGGCCACAGTGAAGGG - Intergenic
1145153009 17:20521860-20521882 ATTTTGCAGGCCACAGTGAAGGG + Intergenic
1146026553 17:29326552-29326574 ATTACCCAGGCTAGAGTGCAGGG - Intergenic
1146258898 17:31408978-31409000 AAGTCCCAGGCAGCAGAGCAGGG + Intronic
1146304292 17:31718813-31718835 ATTGCCCAGGCTGCAGTGCAAGG - Intergenic
1147052802 17:37809110-37809132 AATTGCCAAGTCACAGTGCATGG + Intergenic
1147581352 17:41628869-41628891 ATTTTGCAGGCCACAGTGAAGGG + Intergenic
1147986485 17:44310058-44310080 ATGGCCCAGCCCACAGTGCAGGG + Intronic
1148206368 17:45782839-45782861 CATTCCCAGCTCACAGTGCCTGG - Intergenic
1148737132 17:49871199-49871221 ACTTGCCAGGCCACAGGGCAGGG - Intergenic
1149498378 17:57133456-57133478 AATTAAGAGGCCACAGAGCATGG + Intergenic
1150029561 17:61718684-61718706 AATTACTAGGCCACAGTTCAGGG - Intronic
1150722752 17:67627408-67627430 AATTCTCATGCCAAAGTCCATGG - Intronic
1151466428 17:74288769-74288791 AAAACCGAGGCCACAGAGCATGG - Intronic
1151980916 17:77507921-77507943 CATTCCCAGGCTGCTGTGCAGGG - Intergenic
1152615188 17:81334592-81334614 TATTCCCAGGCCACAGCCCTGGG - Intergenic
1152691396 17:81719730-81719752 AATGCCCAGGCCACCGTGCCTGG + Intronic
1153396897 18:4632785-4632807 AGTTTCCAGGTCACAGTGCAGGG + Intergenic
1155168768 18:23251566-23251588 AATTCAGAGTTCACAGTGCAGGG + Intronic
1156221828 18:35060341-35060363 CATTCCCATGCCACAGGGCTTGG - Intronic
1156233306 18:35175969-35175991 AATTTGCAGGCCATGGTGCAGGG + Intergenic
1156248761 18:35330467-35330489 AATTTCCAGGCCTCAGCACAGGG - Intergenic
1156348929 18:36286168-36286190 AATCCCCAGGTCACAATGAATGG - Intergenic
1158429042 18:57367095-57367117 AATTCCTAGGACACAGTGAGTGG + Exonic
1162358988 19:10206295-10206317 GCTTCCCAGGCCACATTCCAGGG + Intronic
1163011004 19:14426211-14426233 ATCACCCAGGCCAGAGTGCATGG + Intergenic
1164522821 19:28991816-28991838 AGTTCCCAGGCCACAGGGATTGG + Intergenic
1164615430 19:29664580-29664602 AATTCCCAGGCCTCAGTGCCCGG - Intergenic
1165025847 19:32960868-32960890 AATTTCCAGGTCACAGCACAGGG + Intronic
1165947385 19:39452388-39452410 AATTACCAGGGCTCAGTCCAGGG - Intronic
1167004737 19:46768096-46768118 AACTCCCAGGCCAAAGTGTTGGG - Intronic
1167861972 19:52292150-52292172 CTTTCCCAGACCACAGTGAAAGG - Exonic
1168280765 19:55304400-55304422 CCTTCCCAGGCCCCAGAGCAAGG - Intronic
926783557 2:16498074-16498096 ACTACCCAGGGCACAGAGCAGGG + Intergenic
926959087 2:18333885-18333907 AGTTTCCAGGCCACACTGCAGGG - Intronic
927262839 2:21111373-21111395 AATTTCCAGACTACAGTGCAAGG - Intergenic
929196483 2:39190344-39190366 ATTTTCCAGGCCACAGTGGCTGG + Exonic
929214808 2:39401063-39401085 AGTTTCCAGGCCTCAGTGCAGGG + Intronic
929510884 2:42565223-42565245 ATTACCCAGGCTAGAGTGCAGGG + Intronic
929616504 2:43313728-43313750 AATGCCCAGGCCACAGAGAAGGG - Intronic
929616747 2:43315939-43315961 CATTCACAGGCCAAAGTCCAAGG - Intronic
929667106 2:43841641-43841663 CCTTCCCAGGCCACAGTGAAGGG + Intronic
929892024 2:45926025-45926047 AATTCCCAAGCCAAAGTGGGTGG - Intronic
930456623 2:51614453-51614475 AATCCCCATTCCACATTGCAGGG + Intergenic
931924490 2:67056739-67056761 GTTTCCCAGGCTAGAGTGCAGGG + Intergenic
932936850 2:76113478-76113500 GCTTCCCAGGGCACAGAGCAAGG - Intergenic
934880582 2:97973418-97973440 AGTTACTAGGCCACAGTGCAGGG + Intronic
935696961 2:105778411-105778433 ACTTCCCACGCCACAGAGGATGG - Intronic
936176189 2:110222166-110222188 AGTTTCCAGGCCACCGTGCAGGG - Intergenic
936810069 2:116387913-116387935 GTTTCCCAGGACACAGAGCAGGG - Intergenic
936882561 2:117271750-117271772 AGTTCCCAGGGAACTGTGCATGG + Intergenic
937107517 2:119331657-119331679 ACTTTCCAGGCCACAGGGCGGGG - Intronic
938006432 2:127790645-127790667 ATTGCCCAGGCTACAGCGCATGG + Intronic
938870794 2:135474150-135474172 GTCTCCCAGGCCAGAGTGCAGGG - Intronic
939826217 2:147018574-147018596 AATGTACAGGCCACAGTGAAAGG + Intergenic
940140243 2:150485561-150485583 AATTCCCAGCCCTAAGCGCAGGG + Intronic
940283293 2:152009150-152009172 GTTTCCCAGGCTAGAGTGCAGGG - Intronic
940641538 2:156349712-156349734 AACCCCCAGGCCACAGACCAAGG + Intergenic
940912791 2:159223923-159223945 ACTTCCCAGGCCACAGAGACGGG - Intronic
942074851 2:172348070-172348092 AGTTTCCAGGCCACAGTGCAAGG - Intergenic
942274394 2:174308846-174308868 AGTTTCCAGGCTGCAGTGCACGG - Intergenic
942332004 2:174836157-174836179 AGTTTCCAGGCCACAGCACATGG - Intronic
942910540 2:181238053-181238075 ATTTCTCAGGCCATAGTGTAGGG + Intergenic
943541154 2:189216299-189216321 AATTCCCAGGCTAAAGTGGGAGG - Intergenic
943932537 2:193872541-193872563 TATCCCCAGGCTAGAGTGCAGGG + Intergenic
944314807 2:198272881-198272903 AATCCCCATGCCACCCTGCATGG - Intronic
945572169 2:211481993-211482015 AATTTCCAGGTCACAGTGCAAGG + Intronic
946175985 2:217922286-217922308 AACTCCCAGTCCCCAGAGCAGGG - Intronic
946285558 2:218699961-218699983 ACTGCCCAGGCCGGAGTGCATGG + Intronic
948254137 2:236553623-236553645 AATTCCCTGGCCACGGTTGAAGG + Intergenic
1169255628 20:4095044-4095066 AATCTCCAGGCCATAATGCAGGG + Intergenic
1169292725 20:4366404-4366426 CATTCCCAGCCCACAGTGGATGG + Intergenic
1169463522 20:5817906-5817928 ACTTCCTAGACCACAGCGCAGGG - Intronic
1170120477 20:12906311-12906333 AATCCCCAGGAATCAGTGCAGGG + Intergenic
1170217538 20:13907528-13907550 ATTGCCCAGGCTAGAGTGCAGGG - Intronic
1170551288 20:17479648-17479670 AATTACCCGGGCACAGTGGAGGG + Intronic
1170598556 20:17823520-17823542 AAAGCCCACGCCACAGGGCAGGG + Intergenic
1172072583 20:32269359-32269381 ATTACCCAGGCTAAAGTGCAGGG + Intergenic
1172326905 20:34043139-34043161 AAATCCCAGGCCACTGAGCAGGG - Intronic
1172753600 20:37268265-37268287 CAGTCCAAGGCCACTGTGCAAGG + Intergenic
1173723609 20:45281104-45281126 AAATCTCAGCCCACAATGCAGGG - Intergenic
1174416145 20:50368533-50368555 ATCTCCCTGGCCACAGGGCAGGG - Intergenic
1175077791 20:56390632-56390654 ATTGCCCAGGCCAGAGTGCGGGG - Intronic
1175487076 20:59354194-59354216 ACTTCCCAGGTCACAGGGCAGGG + Intergenic
1175548693 20:59801231-59801253 AGTTGCCAGGCCACAATCCAGGG - Intronic
1175775382 20:61649917-61649939 AGATCCCAGGCCACAATGCCTGG - Intronic
1175811723 20:61861991-61862013 ACGTCCCAGGCCACTGTGAACGG + Intronic
1175978914 20:62727353-62727375 AAGTCCCAGCCCAGAGTGCCAGG + Intronic
1176061188 20:63173666-63173688 AATTCCCCAGCAACAGTGCATGG + Intergenic
1176668853 21:9713124-9713146 ACTTCCCATTCCTCAGTGCAAGG - Intergenic
1177208298 21:18036527-18036549 AGTTTCCAGGCCACAGTGCAGGG - Intronic
1177226347 21:18261625-18261647 GTCTCCCAGGCCAGAGTGCATGG - Intronic
1177308331 21:19351465-19351487 AATTTCCAGGCAACTGTGCTGGG + Intergenic
1179593743 21:42428456-42428478 AATCCCCAGGCCACAGCCCTGGG - Intronic
1179789904 21:43750204-43750226 AAGGCCCATGCCACAGCGCAGGG - Intronic
1180003922 21:45011068-45011090 AGTTTCCAGGTCACAGTGCTGGG - Intergenic
1180663940 22:17494731-17494753 GTTGCCCAGGCTACAGTGCAGGG + Intronic
1180746026 22:18089591-18089613 AACACCAAGGACACAGTGCAGGG - Exonic
1181464024 22:23101276-23101298 AATTCCCAGGGGCCAGTGCCAGG - Intronic
1182135737 22:27901332-27901354 AATTTCCAGGGAAAAGTGCATGG - Intronic
1182463086 22:30495873-30495895 AATCCCTGGGTCACAGTGCATGG + Intronic
1183496752 22:38150165-38150187 AATTCCCACTGCTCAGTGCAAGG - Intronic
1184896625 22:47411076-47411098 AGTTGCCAGGCCACAGTTCAGGG + Intergenic
950260787 3:11542372-11542394 AATTCCCAGCCCACAGCGACAGG - Intronic
950284901 3:11736990-11737012 AGTGCCCAGGCTGCAGTGCAGGG + Intergenic
950632123 3:14289064-14289086 TTTTCCCAGGGCACAGTTCAGGG + Intergenic
950734909 3:14998965-14998987 GATGCCCAGGCCAGAATGCAGGG - Intronic
951462838 3:22969640-22969662 AAGTTCCAGGTGACAGTGCATGG + Intergenic
951877686 3:27445373-27445395 AGTTTCCAGGCCACAGCACAGGG - Intronic
953508713 3:43512916-43512938 AGTCTCCAGGCCACAGTGCAGGG + Intronic
955224595 3:57050400-57050422 AAGGCCAAGGCCACAGAGCAGGG + Intronic
956987188 3:74714706-74714728 AATTAGCAGGGCATAGTGCAGGG + Intergenic
958149790 3:89675888-89675910 AATTTTCAGCCCACAGGGCAAGG - Intergenic
958806301 3:98814957-98814979 AGTTTCCAGGCCACAGTGCAGGG + Intronic
961524482 3:127488087-127488109 ATTTCCCTGGCCACAGTGATTGG + Intergenic
962256875 3:133877101-133877123 AAATTCCAGGCCACAGCACAGGG + Intronic
962717760 3:138141916-138141938 AATTTCTAGGCCACAGTACAGGG + Intergenic
962823745 3:139080069-139080091 ATTGCCTAGGCCAGAGTGCAGGG - Intronic
964629890 3:158799147-158799169 AATTTCTAGGCCACACTGCTGGG + Intronic
967822412 3:193850283-193850305 AAGACCCAGGCCACACTGCAAGG + Intergenic
967832801 3:193935382-193935404 AGTTACCAGGTCACCGTGCAAGG + Intergenic
968462981 4:735039-735061 CCTTCCCAGGCCACAGTACGTGG + Intronic
969613882 4:8241356-8241378 AATCCTCAGGCCACTGTGCGCGG + Intronic
970327599 4:14943498-14943520 TATTCCCAGCACACAGTCCAGGG + Intergenic
972733871 4:41820912-41820934 TATTACCAGGCTACAGTGTAAGG + Intergenic
974148334 4:57973466-57973488 AATTCCCATTCCACAGTGGGGGG - Intergenic
974562550 4:63540905-63540927 TATTCCCAGGCCAGAGTGTAAGG + Intergenic
975331936 4:73126051-73126073 AGTTTCCAGGCTATAGTGCAAGG + Intronic
976606940 4:86992508-86992530 AATTCCCAAGTGACAGTGTAGGG + Intronic
976783238 4:88785790-88785812 AACTCCCAGCCCACACTGAACGG - Intronic
979670854 4:123358805-123358827 AATACCCTGGCCACAGAGAATGG + Intergenic
981127774 4:141126525-141126547 AACCCCAAGGTCACAGTGCATGG - Intronic
981138858 4:141243750-141243772 ATTTTGCAGGCCACAGTGTAGGG - Intergenic
981183774 4:141777468-141777490 AATTACCAGGACAGAGTGGAAGG + Intergenic
981827682 4:148962520-148962542 AATTACCAGGGCACCTTGCAAGG - Intergenic
982135052 4:152267379-152267401 AATTCCCTGAACACAGTGAATGG + Intergenic
982880930 4:160714233-160714255 ACTTCCCAGGCTCCAGAGCATGG - Intergenic
983461899 4:168036091-168036113 ACTTTCCAGGCCACAGTAGAAGG - Intergenic
985190280 4:187365423-187365445 AATCCCAACCCCACAGTGCAGGG + Intergenic
985405929 4:189638389-189638411 ACTTCCCATTCCTCAGTGCAAGG + Intergenic
985491564 5:182721-182743 AGTTTGCAGGCCTCAGTGCAGGG + Exonic
986095136 5:4547191-4547213 AATGCCCAGGCCACACCACAGGG - Intergenic
986283807 5:6345444-6345466 TATTCCCAGGCCCCAGTGCTAGG - Intergenic
986647657 5:9933648-9933670 AAGTCCCAGGCCTCAGAGGAAGG + Intergenic
987131030 5:14860309-14860331 AAGTCCAAGGCCACAGTGACTGG - Intronic
988684541 5:33514421-33514443 CAGTCCCCTGCCACAGTGCATGG + Intergenic
989160034 5:38381785-38381807 GCTTCCCAGGGCACAGGGCAGGG + Intronic
991719455 5:69481768-69481790 AACTCCCAGGCCACGGACCATGG - Intergenic
992161392 5:74007085-74007107 AATTTCCAGACCACAATACAGGG - Intergenic
993037213 5:82770927-82770949 AGTTTCCAGGTCACAGTGCAAGG - Intergenic
996143061 5:119938578-119938600 AATTTACAGACCACAGTGCAGGG - Intergenic
997236673 5:132275931-132275953 AATCCCCAGGCCATAGACCATGG + Intronic
998479645 5:142452084-142452106 AGTTTCCAGGCCATAGTGCAGGG - Intergenic
998719508 5:144927989-144928011 AATACCCAGGCACCAGAGCAAGG + Intergenic
999182252 5:149678008-149678030 ACTCCCCAGGCCCCAGTGCCCGG + Intergenic
999673083 5:153974511-153974533 AATTCTCAGGTCACACTGGATGG + Intergenic
999709425 5:154303253-154303275 AATTTCCAGGCCATGGTACAGGG + Intronic
999835966 5:155373063-155373085 AATTTCCAAGCTACAGTACAGGG - Intergenic
1000278335 5:159760176-159760198 CATTCCTTGGCCACAGTGCTTGG + Intergenic
1001160938 5:169312321-169312343 AATTTCCAGGATGCAGTGCAGGG + Intergenic
1002573205 5:180155779-180155801 ACTCCCCAAGCCACAGTGAAGGG + Intronic
1004305382 6:14497276-14497298 AACTTCCAGGCTGCAGTGCAGGG - Intergenic
1004679233 6:17876277-17876299 AAATGCCAGGCCAAAGAGCATGG - Intronic
1005562892 6:27059540-27059562 AATCATCAGACCACAGTGCAAGG - Intergenic
1006098097 6:31668772-31668794 AATTCCCAGGCCCAAGTTCTGGG - Intronic
1007176099 6:39898770-39898792 GACTCCCAGGCCACTGTGCTTGG + Intronic
1008019150 6:46556254-46556276 AGTCTTCAGGCCACAGTGCAAGG + Intronic
1009574036 6:65429234-65429256 AATTACCAGGGGCCAGTGCATGG + Intronic
1009966486 6:70583873-70583895 AAATCCCAGGTTACAGTGTAAGG + Intronic
1015949984 6:138542800-138542822 ATTGCCCAGGCTAGAGTGCAGGG + Intronic
1017667909 6:156739410-156739432 GTTTCCCAGGCTAGAGTGCAAGG + Intergenic
1019288031 7:233485-233507 TCTTCCCAGCCCAGAGTGCAGGG + Intronic
1019595987 7:1858630-1858652 CAGACCCACGCCACAGTGCAGGG + Intronic
1020047586 7:5054005-5054027 TGTTTCCAGGCCACAGAGCAGGG - Intronic
1020471455 7:8540481-8540503 GGTTTCCAGGCCACTGTGCAGGG + Intronic
1020585777 7:10064741-10064763 AGTTTCCAGGTCATAGTGCAGGG + Intergenic
1020751964 7:12152710-12152732 AATTTCCAGACCACAGCACAGGG - Intergenic
1021172242 7:17413067-17413089 AACTCCCAGGCCAAAGTCAAAGG - Intergenic
1021738442 7:23661731-23661753 AGTTTCCAGGCCACAGCACAGGG - Intergenic
1022754244 7:33268428-33268450 AGTTTCTAGGCCATAGTGCAGGG - Intronic
1025254473 7:57374210-57374232 ATCTCCCTGGCCACAGGGCAGGG + Intergenic
1027000229 7:74647726-74647748 GTTACCCAGGCTACAGTGCAGGG - Intergenic
1027416283 7:77978129-77978151 AGTTCCCAGGCAGCAGTGCCAGG - Intergenic
1028439962 7:90848443-90848465 AGTTCCCAGGCCATACTGCCAGG - Intronic
1030397603 7:109006895-109006917 AATCCTAAGGCCACATTGCAGGG + Intergenic
1030514277 7:110520457-110520479 GACTCCCAGGCCACAGTGTTGGG - Intergenic
1030706982 7:112702948-112702970 ATTGCCCAGGCTACAGTGCAGGG - Intergenic
1031303249 7:120090271-120090293 AATTTACAGGCCATAGTGCAGGG - Intergenic
1032006462 7:128305786-128305808 AAGGCCCAGACCACAATGCAGGG + Exonic
1032333734 7:131005013-131005035 GTTGCCCAGGCCATAGTGCAGGG + Intergenic
1032840735 7:135711572-135711594 ATCTCCCAGGTCACAGTGTAAGG + Intronic
1032907847 7:136392801-136392823 AATTTCTAGGCCAGAGTGCATGG + Intergenic
1035062926 7:156082345-156082367 AGTTCCTAGGCCACAGTGTTGGG - Intergenic
1035368719 7:158364818-158364840 ACTTTCCAGGCCACAGTCCTTGG - Intronic
1035616462 8:1005740-1005762 AGTTCCCAGGGCACAAGGCATGG - Intergenic
1037346302 8:17904999-17905021 CATTCCAAACCCACAGTGCAGGG - Intronic
1037446973 8:18974955-18974977 AATGCCATGGCAACAGTGCATGG - Intronic
1037787170 8:21909955-21909977 ATTGGCCAGGCCACAGGGCAGGG + Intronic
1037995464 8:23349150-23349172 AATTCCCAGTCAGCTGTGCAAGG + Intronic
1040338645 8:46428845-46428867 AAGTCCCAGGCTTCAGAGCAGGG + Intergenic
1041799457 8:61783495-61783517 AATTACCAGACCACAGAGAAGGG + Intergenic
1042670922 8:71262544-71262566 TTTTCCAAGGCCACAGAGCAAGG + Intronic
1043157541 8:76802973-76802995 AAGTCCTAGACCACAGAGCAAGG + Intronic
1044280505 8:90349947-90349969 CATTTCCAGGCCACAGTCCACGG - Intergenic
1044502726 8:92978246-92978268 AGTTTCCAGGCCACAGCACATGG - Intronic
1046249474 8:111611548-111611570 ATTTTCCAGGCTACAGAGCATGG - Intergenic
1046647230 8:116799398-116799420 AGTTTCCAGGCTACAGAGCATGG - Intronic
1046906676 8:119581361-119581383 GCCTCCCAGGCCACAGAGCAGGG - Intronic
1047410210 8:124618257-124618279 AAGTCCCAGACCTCAGTGGAAGG + Intronic
1047907125 8:129484174-129484196 AGTTTCCAGGCCACAGCACAGGG + Intergenic
1049132350 8:140858065-140858087 AATTGCCAGGCCACTTTGTATGG - Intronic
1050087781 9:1984535-1984557 AGTTCCAGGGCCACAGTGAAAGG + Intergenic
1052202295 9:25798050-25798072 AATTTCCAGTCTCCAGTGCAAGG + Intergenic
1052832863 9:33229905-33229927 AATTTCCAGGCCACATTGATTGG + Intronic
1053482765 9:38428228-38428250 ACTTTCCAGGCCACTCTGCAGGG + Intergenic
1053721646 9:40952304-40952326 GTTTCCCAGGCCGGAGTGCAGGG - Intergenic
1057325311 9:94058077-94058099 AGTTTCCAGGCTTCAGTGCAGGG + Intronic
1059935454 9:119305841-119305863 TATCCCCAGGAAACAGTGCAGGG + Intronic
1059994244 9:119893551-119893573 AACTCTCAGGGCACAGAGCAGGG - Intergenic
1060090392 9:120737903-120737925 AATTTCAAGGCCAGAGGGCATGG - Intergenic
1060875590 9:127081471-127081493 AATGCCCAGGCAAGTGTGCAGGG - Intronic
1061524637 9:131149186-131149208 AGTGCCCAGGTCACAGTTCACGG + Intronic
1061991731 9:134163143-134163165 ACATCCCAGGCCTCAGTGCCGGG + Intergenic
1061992235 9:134165700-134165722 CATTCCCAGCCCACAGCACACGG - Intergenic
1062050004 9:134442374-134442396 AGTTCTCAGGCCAGAGCGCAGGG + Intergenic
1203453507 Un_GL000219v1:143692-143714 GTTTCCCAGGCCCGAGTGCAGGG + Intergenic
1203657013 Un_KI270753v1:7811-7833 ACTTCCCATTCCTCAGTGCAAGG + Intergenic
1187757710 X:22545589-22545611 GATTCCAGGGCCACAGTGCATGG - Intergenic
1188002038 X:24991943-24991965 AATTCACAAGGCACAGTGCCAGG - Intronic
1188286218 X:28328109-28328131 ACTTCCCAGGATACAATGCATGG + Intergenic
1189502316 X:41574276-41574298 AGTTTCCAGGCCACAGCACAGGG - Intronic
1189593618 X:42541660-42541682 AATTCCCAGGCCCCATAGGAGGG - Intergenic
1190178824 X:48174262-48174284 GTTGCCCAGGCCAGAGTGCAGGG + Intergenic
1191971449 X:66821435-66821457 AATTCCCAGGATGCAGAGCAAGG + Intergenic
1195759959 X:108235553-108235575 AACTCCCAGGCCAGAGTCTATGG + Intronic
1196055439 X:111350203-111350225 GCTTCCCAGGACACAGAGCAGGG + Intronic
1196906509 X:120442189-120442211 TATGCCCAGGCCAGATTGCAGGG - Intronic
1198083322 X:133260339-133260361 AGATCCCAGGCTACAGTGCAAGG + Intergenic
1199916167 X:152343216-152343238 AATTTTTAGGCTACAGTGCAGGG - Intronic
1200055528 X:153457999-153458021 AAGGCACAGGCCACAGTGAAAGG - Intronic
1200212544 X:154353199-154353221 AAATCCCTGGACACAGGGCATGG + Exonic
1200694241 Y:6344146-6344168 ATTACCCAGGCTAGAGTGCATGG - Intergenic
1201041036 Y:9830570-9830592 ATTACCCAGGCTAGAGTGCATGG + Intergenic
1201984524 Y:19951261-19951283 GTCTCCCAGGCCAGAGTGCAGGG - Intergenic