ID: 1062776088

View in Genome Browser
Species Human (GRCh38)
Location 10:149236-149258
Sequence CAATTCCCAGGCCACAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062776088_1062776092 1 Left 1062776088 10:149236-149258 CCTGCACTGTGGCCTGGGAATTG 0: 1
1: 0
2: 1
3: 34
4: 315
Right 1062776092 10:149260-149282 TGTGAGGCAGAACACTGAGGTGG No data
1062776088_1062776091 -2 Left 1062776088 10:149236-149258 CCTGCACTGTGGCCTGGGAATTG 0: 1
1: 0
2: 1
3: 34
4: 315
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062776088 Original CRISPR CAATTCCCAGGCCACAGTGC AGG (reversed) Intronic
900309650 1:2027582-2027604 CATGTCGCAGGCCACAGTGGAGG - Exonic
900414819 1:2530135-2530157 CAGCTCCACGGCCACAGTGCTGG + Exonic
900476272 1:2877840-2877862 AAATCCCCAGGCCTCATTGCAGG + Intergenic
901245847 1:7730385-7730407 CTATTACCAGGCCTCAGTTCTGG + Intronic
901455946 1:9362939-9362961 GAGGCCCCAGGCCACAGTGCAGG + Intronic
901461541 1:9394844-9394866 CATCTCCCTGGTCACAGTGCAGG - Intergenic
902178901 1:14672716-14672738 CAATGCCCAGACCCCATTGCAGG + Intronic
902197667 1:14809815-14809837 CCCATCACAGGCCACAGTGCTGG + Intronic
902632607 1:17714332-17714354 CATTTCCCAGGGCCCTGTGCAGG + Intergenic
902752777 1:18528865-18528887 GAATTCCCAGGCCATGCTGCAGG + Intergenic
903755407 1:25657213-25657235 CATTACCCAGGGCACAGTTCTGG + Intronic
904755201 1:32765195-32765217 CCAGTCCCAGGACACAGTCCTGG - Intronic
904815849 1:33197636-33197658 GAGTTTCCAGGCCACAGTACGGG + Intergenic
904915270 1:33965681-33965703 TAATTTTCAGGGCACAGTGCTGG + Intronic
905242139 1:36588251-36588273 CAAATCCCAGGCCCCAGCTCAGG + Intergenic
905849814 1:41265328-41265350 AAATTCCTAGGCCACTGGGCCGG - Intergenic
906316767 1:44791536-44791558 AAATTCACAGACCACAGGGCTGG - Intergenic
907301198 1:53487235-53487257 GAATTCCCAGGCCACAAAGCAGG - Intergenic
907826364 1:58020971-58020993 CAATGCCCAGGCTGGAGTGCAGG - Intronic
908328693 1:63049235-63049257 CATTCCCCATGCCAAAGTGCTGG + Intergenic
909478608 1:76110521-76110543 CACTCCCAAAGCCACAGTGCAGG - Intronic
909534518 1:76721367-76721389 GACTTTCCAGGCCTCAGTGCAGG + Intergenic
912381614 1:109250631-109250653 CAGCTACCAGGCCACAGTGCCGG + Exonic
912478459 1:109958902-109958924 CTATTCCCAGTTTACAGTGCAGG - Intergenic
912944868 1:114076479-114076501 CCCTTCCCTGGCCAAAGTGCAGG - Intergenic
913219896 1:116650941-116650963 CAGGCCCCAGGCCAGAGTGCTGG + Intronic
913962425 1:143350710-143350732 CAGTTCTCAGGACACAGTGTGGG + Intergenic
914056780 1:144176287-144176309 CAGTTCTCAGGACACAGTGTGGG + Intergenic
914122366 1:144790075-144790097 CAGTTCTCAGGACACAGTGTGGG - Intergenic
916076198 1:161201232-161201254 CAATTCCCAGGCCAGAAGTCTGG + Intronic
916622470 1:166514952-166514974 CAGTTTCCAGGCCACAATGATGG - Intergenic
917584175 1:176408608-176408630 CAGTTTCCAGGCCATAGTGCAGG - Intergenic
917919885 1:179742868-179742890 GGATTTCCAGGGCACAGTGCGGG + Intergenic
918388891 1:184037546-184037568 CACCGCCCAGGCCCCAGTGCGGG + Exonic
921268439 1:213445732-213445754 CATTTCCCAGGCGAAAGTGTGGG - Intergenic
922035338 1:221842164-221842186 CAACACCCAGAGCACAGTGCTGG + Intergenic
922500124 1:226091136-226091158 CGTTCCCCAGGCCACAGTGACGG + Intergenic
923296154 1:232596894-232596916 CAAGGACCAGGCCACCGTGCAGG + Intergenic
924026683 1:239840900-239840922 CACTTCACATGCCAGAGTGCTGG - Intronic
1062776088 10:149236-149258 CAATTCCCAGGCCACAGTGCAGG - Intronic
1062795372 10:341218-341240 CAAATCCCAGTCCACAGTAAGGG + Exonic
1062828401 10:588316-588338 AAGTTCCCAGGACACAGTCCTGG - Intronic
1064130935 10:12709011-12709033 CCACTCCCATGCCACAGTTCAGG - Intronic
1064781608 10:18845523-18845545 GAATTTCCAGGCTTCAGTGCAGG + Intergenic
1065577180 10:27132993-27133015 TAATTCTCAGGCCACAGCACAGG + Intronic
1065780659 10:29163659-29163681 CAAGTCCCAGCCCAAAGTGTGGG + Intergenic
1066138346 10:32475254-32475276 GAATTGCCAGTCCACAGTGTAGG - Intronic
1067184605 10:44016094-44016116 CCACTCCCAGGCCACAAAGCAGG - Intergenic
1067199681 10:44156563-44156585 CAGTTCCCAGGCCACACAGCAGG - Intergenic
1068510114 10:57955011-57955033 CATTGCCCAGGTCACAGTGATGG - Intergenic
1069901702 10:71710328-71710350 CACTTCCCTGGCTACAGTGAGGG - Intronic
1070150087 10:73800156-73800178 CAACTCACAGGCCACACTGGTGG - Exonic
1071430652 10:85603814-85603836 CAGCTCCCAGGCCACCCTGCAGG + Intronic
1071461857 10:85904355-85904377 GAATTTCCATGACACAGTGCAGG + Intronic
1073033010 10:100543142-100543164 CAATTCACAAGCCACATGGCCGG - Intronic
1073469437 10:103713786-103713808 TAATTCCCAGGCCACACAGCAGG + Intronic
1074272538 10:111969122-111969144 AAATTCCTAGGACACATTGCAGG + Intergenic
1074914002 10:117938389-117938411 CCCTCCCCAGTCCACAGTGCTGG - Intergenic
1075024904 10:118977325-118977347 CAATTCCCAGCCCAAGGTGGAGG + Intergenic
1075064460 10:119280097-119280119 CAACTCCCTGGGCACAGAGCAGG - Intronic
1076569982 10:131426208-131426230 CGCTTCCCAGGCTGCAGTGCTGG - Intergenic
1076751816 10:132547100-132547122 CAGGTGCCAGGCCACAGTCCAGG + Intronic
1077028136 11:450744-450766 CAAACCCCCGGCCACAGTCCTGG - Intronic
1077053425 11:578045-578067 CATGTCCCAGGCCACAGGCCAGG - Intronic
1077440920 11:2568694-2568716 CATTTCCCAGGCCCCAGAACAGG - Intronic
1077443299 11:2578625-2578647 CCATTCCCAGGTCACTGTGCTGG - Intronic
1078144346 11:8712855-8712877 CCATCCCCAGCTCACAGTGCAGG + Intronic
1078778692 11:14416922-14416944 CCATTCCCAGGCCCCATAGCTGG + Intergenic
1081663865 11:44905001-44905023 CAAAACCCTGGGCACAGTGCTGG + Intronic
1083663237 11:64261782-64261804 CAAGCCCCAGGCCAGGGTGCAGG - Intronic
1084044539 11:66561178-66561200 CATTTCCCAGCCCCCAGAGCTGG + Intronic
1084862725 11:72031263-72031285 TGTTGCCCAGGCCACAGTGCAGG - Intronic
1085270233 11:75265874-75265896 CAATTCCAAGGCCAGAGCCCTGG + Exonic
1085404228 11:76252338-76252360 CAATGCCCCGGCCAGGGTGCCGG - Intergenic
1085542835 11:77288427-77288449 CAATCCTCAGGCCCCAGTGGTGG - Intronic
1085654105 11:78296810-78296832 AAATTTACAGTCCACAGTGCTGG + Intronic
1088123908 11:106400212-106400234 CAATTACCAGGCGCCAGTCCTGG - Intergenic
1089281429 11:117377363-117377385 CAACCCCCAGGCCACAGAGCAGG - Intronic
1089687215 11:120160976-120160998 CAGTTTCCAGGTCACAGAGCAGG - Intronic
1090428894 11:126629583-126629605 AGATTCCCAGGGCACAGGGCAGG - Intronic
1091038828 11:132257538-132257560 GAGTTCCCAGGCCACACTGCAGG - Intronic
1091814911 12:3430308-3430330 CCAGGCCCAGGGCACAGTGCTGG + Intronic
1094378750 12:29819445-29819467 CAATTCCCATGGCTCATTGCTGG + Intergenic
1094830518 12:34298057-34298079 CTATCCCCAGGGCCCAGTGCAGG - Intergenic
1095321950 12:40838558-40838580 CAGTGTTCAGGCCACAGTGCTGG - Intronic
1096277377 12:50221302-50221324 CAATCCAGAGGCCACAGAGCTGG - Intronic
1098234157 12:68402321-68402343 CCATTCCCTGGTCACAGTTCAGG + Intergenic
1100390061 12:94140184-94140206 CAATTACCAGGCCATAATTCCGG + Intergenic
1100983402 12:100182146-100182168 CAGTTTCCAGGCCAGGGTGCAGG + Intergenic
1101133473 12:101713498-101713520 CAGTTTCCAGGCCACAGTGCAGG - Intronic
1101480278 12:105090152-105090174 GAACTATCAGGCCACAGTGCAGG - Intergenic
1101847043 12:108370910-108370932 AAAGTCCAAGGCCACAGTGCTGG - Intergenic
1101953939 12:109197413-109197435 CACCTCGCAGGCCACAGAGCTGG - Intronic
1103044719 12:117726470-117726492 CCATTCCCAGGCCCCAGTAATGG - Intronic
1103323193 12:120103370-120103392 CACTTCCAAGGCATCAGTGCAGG + Intronic
1105468424 13:20669015-20669037 CTACTCCCAGGACACTGTGCTGG - Intronic
1107564622 13:41589454-41589476 CAACTCCCAGGACACAGAGCAGG - Intronic
1113489850 13:110682796-110682818 CCATTCCCTGGAGACAGTGCTGG - Intronic
1113924050 13:113930538-113930560 CACTTCCCAGGTCAGAGTCCTGG + Intergenic
1114362986 14:21996599-21996621 CAATTTCAAGGTCAAAGTGCTGG - Intergenic
1114606418 14:24001431-24001453 CAATACCCTGGCCATAGAGCTGG + Exonic
1115307360 14:31946240-31946262 CAATGCCCAGGCCACACCCCAGG - Intronic
1116860847 14:49994483-49994505 CATTTCCAAGGCCACATCGCTGG - Intronic
1118356375 14:65017241-65017263 CAATCCCCAGGCCCCCGAGCTGG - Intronic
1118436134 14:65772318-65772340 CTCTTCCCAGGCCACAGAGGAGG - Intergenic
1120290038 14:82556644-82556666 CAATTTCCAGACCACAGCACAGG - Intergenic
1121022930 14:90592778-90592800 CAGTTCCCAGGGCACTCTGCTGG - Intronic
1121916631 14:97841598-97841620 CAATTCCCAGAACACAGCACGGG - Intergenic
1122158305 14:99764410-99764432 CACTTCCCTGGCCACCGTCCTGG + Intronic
1122369310 14:101220276-101220298 CAGTTTCCAGGCCATGGTGCAGG - Intergenic
1122908646 14:104815669-104815691 CAACTCCCACGCCACAGCCCTGG + Intergenic
1123205503 14:106708884-106708906 CAAATCCCAGGCCCCAGCCCAGG - Intergenic
1123210550 14:106756151-106756173 CAAATCCCAGGCCCCAGCCCAGG - Intergenic
1125979580 15:43988191-43988213 CAACCCCCAGGCCACAGACCAGG - Intronic
1127271109 15:57402860-57402882 TATTTCCCAGCCCTCAGTGCAGG + Intronic
1128434983 15:67637782-67637804 GAGTTCCCAGGCCTCAGTGCAGG - Intronic
1128541926 15:68541978-68542000 GAGTTTCCAGGCCACGGTGCAGG - Intergenic
1129331524 15:74830294-74830316 CAAGGCCCAGGCCACACTGGGGG + Exonic
1129602047 15:77004948-77004970 CAATGCCCAGGCCACACCCCAGG + Intronic
1130336215 15:82959198-82959220 CATTCCCCTGGCCACAGTGATGG - Intronic
1130693081 15:86103717-86103739 CAATCCTCAGGCCCCAGTGAAGG + Intergenic
1131386468 15:92012379-92012401 CCCTTCCCAGCCCACAGTTCTGG + Intronic
1131492169 15:92872638-92872660 GCATTTCCAGGCCTCAGTGCTGG - Intergenic
1131765090 15:95667448-95667470 CAATTCACAAGCTACAGTTCAGG - Intergenic
1132881221 16:2162534-2162556 CCAGTCCCAGGCCAAAGTGGCGG - Intronic
1134041886 16:11075354-11075376 CATATCCAAGGTCACAGTGCTGG - Intronic
1134356797 16:13489849-13489871 CATTCCCAAGGTCACAGTGCAGG + Intergenic
1136505379 16:30699292-30699314 AAATTCCTAAACCACAGTGCCGG - Intronic
1138346706 16:56324649-56324671 CAAAGCCCAGGCCCCAGGGCTGG + Intronic
1138454701 16:57114538-57114560 CAGTCCCCAGGGCACAGAGCAGG + Intronic
1139367889 16:66444823-66444845 CAATGCTCCCGCCACAGTGCCGG - Intronic
1140220348 16:73039353-73039375 CAACTCCCAGGCTGCAGTGAAGG + Intronic
1141365658 16:83440413-83440435 CAGTTCCCATTCCACAGTGTTGG - Intronic
1141826984 16:86487325-86487347 GAGTTCCTGGGCCACAGTGCTGG - Intergenic
1142201255 16:88762135-88762157 CCCTTCCCAGGGCACAGTGGGGG - Intronic
1142617847 17:1146920-1146942 CACTGCCCTGGCCACAGAGCAGG + Intronic
1143972351 17:10804749-10804771 CAATTCCCAGGCAAAAGTCAAGG + Intergenic
1146026554 17:29326553-29326575 CATTACCCAGGCTAGAGTGCAGG - Intergenic
1146258897 17:31408977-31408999 CAAGTCCCAGGCAGCAGAGCAGG + Intronic
1148172547 17:45534854-45534876 CAATGCGCTGGACACAGTGCCGG + Intergenic
1148276723 17:46310596-46310618 CAATGCGCTGGACACAGTGCCGG - Intronic
1148298840 17:46528184-46528206 CAATGCGCTGGACACAGTGCCGG - Intronic
1148363372 17:47032681-47032703 CAATGCGCTGGACACAGTGCCGG - Intronic
1148737133 17:49871200-49871222 GACTTGCCAGGCCACAGGGCAGG - Intergenic
1150029562 17:61718685-61718707 CAATTACTAGGCCACAGTTCAGG - Intronic
1150322623 17:64228709-64228731 CAATCCCCGGGCCACAGACCAGG - Intronic
1150403751 17:64881777-64881799 CAATGCGCTGGACACAGTGCCGG + Intronic
1150489590 17:65565070-65565092 CAGTTTCCAGGCAACCGTGCAGG - Intronic
1151392285 17:73795512-73795534 CAACCCCCAGGGCCCAGTGCGGG - Intergenic
1151980917 17:77507922-77507944 CCATTCCCAGGCTGCTGTGCAGG - Intergenic
1152376744 17:79922508-79922530 CGATGCCAAGGCCACAGTGATGG - Intergenic
1152615189 17:81334593-81334615 CTATTCCCAGGCCACAGCCCTGG - Intergenic
1153396896 18:4632784-4632806 GAGTTTCCAGGTCACAGTGCAGG + Intergenic
1153770576 18:8412391-8412413 GCATGCCCAGGCCCCAGTGCTGG + Intergenic
1155220530 18:23681306-23681328 CGTTGCCCAGGCTACAGTGCAGG - Intergenic
1155537580 18:26832996-26833018 CAATTCCCAGGCTGCAGTGTGGG - Intergenic
1156088737 18:33440511-33440533 CAATTCCCTGGCCACCCTGAGGG - Intronic
1156315046 18:35961975-35961997 CAATCCCCAGGCCACTGACCAGG + Intergenic
1157615843 18:48987287-48987309 CAGTTCCTAGGCCCCAGTGGGGG + Intergenic
1163561792 19:18023624-18023646 CCAGGCCCAGGCCACAGTCCAGG + Intergenic
1163698686 19:18776502-18776524 CAGAGCCCAGGCCACAGTGGGGG - Intronic
1164756308 19:30692238-30692260 GAATTCCCAGCCCTCGGTGCAGG - Intronic
1164904956 19:31959824-31959846 CAGTGCCAACGCCACAGTGCTGG - Intergenic
1165947386 19:39452389-39452411 CAATTACCAGGGCTCAGTCCAGG - Intronic
1167004738 19:46768097-46768119 GAACTCCCAGGCCAAAGTGTTGG - Intronic
1167257027 19:48436824-48436846 CATCTCCCAGGCCAGAGTGAGGG + Intronic
1167811267 19:51833223-51833245 GAGTTCCCAGGCCACAGAGTAGG - Intergenic
1167864507 19:52313700-52313722 CAATTCACAGGCCAGGGTGGTGG + Intronic
1202696264 1_KI270712v1_random:128972-128994 CAGTTCTCAGGACACAGTGTGGG + Intergenic
925066653 2:933050-933072 CAATTCCCAGGCAGCGCTGCGGG + Intergenic
926152466 2:10432691-10432713 CTCTTCCCAGGCCACAGTAAGGG - Intergenic
926626828 2:15097328-15097350 AGAATCCCAGGCCACAGTGGAGG + Intergenic
926783556 2:16498073-16498095 CACTACCCAGGGCACAGAGCAGG + Intergenic
926959088 2:18333886-18333908 TAGTTTCCAGGCCACACTGCAGG - Intronic
927428909 2:23009805-23009827 CACTGCCCAGGCCACACTGCAGG + Intergenic
928600790 2:32901580-32901602 CAAGTTACAGACCACAGTGCTGG + Intergenic
929214807 2:39401062-39401084 CAGTTTCCAGGCCTCAGTGCAGG + Intronic
929616505 2:43313729-43313751 GAATGCCCAGGCCACAGAGAAGG - Intronic
929667104 2:43841640-43841662 GCCTTCCCAGGCCACAGTGAAGG + Intronic
933656241 2:84889207-84889229 CAACTCCACAGCCACAGTGCTGG + Intronic
933981740 2:87556155-87556177 CCATTCCCAGACCACATAGCTGG - Intergenic
934277427 2:91585997-91586019 CAGTTCTCAGGACACAGTGTGGG + Intergenic
934880581 2:97973417-97973439 GAGTTACTAGGCCACAGTGCAGG + Intronic
936176190 2:110222167-110222189 GAGTTTCCAGGCCACCGTGCAGG - Intergenic
936312096 2:111394662-111394684 CCATTCCCAGACCACATAGCTGG + Intergenic
937107518 2:119331658-119331680 CACTTTCCAGGCCACAGGGCGGG - Intronic
940800069 2:158123457-158123479 GATTTCCCTGGGCACAGTGCTGG + Intronic
940912792 2:159223924-159223946 CACTTCCCAGGCCACAGAGACGG - Intronic
941358775 2:164525606-164525628 GAATTCCCAGGCCTCATTCCTGG + Intronic
942195679 2:173517075-173517097 CAATTTCCAGACAACTGTGCAGG + Intergenic
942910539 2:181238052-181238074 CATTTCTCAGGCCATAGTGTAGG + Intergenic
943932536 2:193872540-193872562 CTATCCCCAGGCTAGAGTGCAGG + Intergenic
944313215 2:198258450-198258472 CAGTTCACAGGTGACAGTGCTGG + Intronic
944361490 2:198862499-198862521 TGAGTCCCAGGCCACAGTGCTGG - Intergenic
946228402 2:218277054-218277076 CAATTCCCAGGACACAGAAGAGG + Exonic
947717522 2:232349350-232349372 CACAGCCCAGGCCACAGTGTGGG - Intergenic
947840481 2:233204480-233204502 CAGCTCCCAGGCCCCGGTGCCGG + Exonic
948117607 2:235505284-235505306 CAGCTCCCAGGACACAGCGCTGG - Intronic
948354741 2:237368962-237368984 CAGATCCCAGGCCCCGGTGCTGG - Exonic
1169463523 20:5817907-5817929 CACTTCCTAGACCACAGCGCAGG - Intronic
1169785296 20:9353671-9353693 TAATTCCCAGGCCTCAGACCTGG + Intronic
1170217539 20:13907529-13907551 CATTGCCCAGGCTAGAGTGCAGG - Intronic
1170598555 20:17823519-17823541 CAAAGCCCACGCCACAGGGCAGG + Intergenic
1171186593 20:23127750-23127772 CAGTGCCCAGGCCCCAGTCCAGG - Intergenic
1172072582 20:32269358-32269380 CATTACCCAGGCTAAAGTGCAGG + Intergenic
1172080029 20:32332982-32333004 CAGTTCCCAGGGCACATTTCTGG + Exonic
1172244829 20:33438730-33438752 CACCTCCCAGCCCCCAGTGCTGG + Intronic
1172326906 20:34043140-34043162 CAAATCCCAGGCCACTGAGCAGG - Intronic
1172801229 20:37577625-37577647 CAACCCCCAGGCCACATAGCAGG + Intergenic
1174034849 20:47662492-47662514 CAATACCAAGGCCACAGTACAGG + Intronic
1175077792 20:56390633-56390655 CATTGCCCAGGCCAGAGTGCGGG - Intronic
1175177325 20:57120112-57120134 CTTTTCCCAGGGCACACTGCTGG + Intergenic
1175487075 20:59354193-59354215 AACTTCCCAGGTCACAGGGCAGG + Intergenic
1177208299 21:18036528-18036550 GAGTTTCCAGGCCACAGTGCAGG - Intronic
1177308330 21:19351464-19351486 CAATTTCCAGGCAACTGTGCTGG + Intergenic
1178448171 21:32664406-32664428 CCAGGCCCAGGGCACAGTGCTGG - Intronic
1178637444 21:34316880-34316902 CAATTCCCAGGACATAGGGTAGG - Intergenic
1179593744 21:42428457-42428479 TAATCCCCAGGCCACAGCCCTGG - Intronic
1179727158 21:43347057-43347079 CAGCTCCCAGACCACAGTGAGGG + Intergenic
1179945540 21:44671474-44671496 CAAATCTCAGGCCCCAGTGGTGG - Intronic
1180003923 21:45011069-45011091 GAGTTTCCAGGTCACAGTGCTGG - Intergenic
1180746027 22:18089592-18089614 CAACACCAAGGACACAGTGCAGG - Exonic
1180821192 22:18828972-18828994 CAGGCCCCAGGCCAGAGTGCTGG + Intergenic
1181191786 22:21147073-21147095 CAGGCCCCAGGCCAGAGTGCTGG - Intergenic
1181207410 22:21263437-21263459 CAGGCCCCAGGCCAGAGTGCTGG + Intergenic
1182148975 22:28015291-28015313 CAGTGGCCAGGCCACAGGGCAGG - Intronic
1183509988 22:38229109-38229131 CAGGGCCCAGGCCACAGGGCGGG - Intronic
1183525023 22:38317566-38317588 CAGTTCCCCAGCCTCAGTGCAGG + Intronic
1184222931 22:43111984-43112006 CCCTTCCGAGGCCACAGGGCTGG - Intronic
1184896624 22:47411075-47411097 GAGTTGCCAGGCCACAGTTCAGG + Intergenic
1203219508 22_KI270731v1_random:31979-32001 CAGGCCCCAGGCCAGAGTGCTGG - Intergenic
1203271317 22_KI270734v1_random:54848-54870 CAGGCCCCAGGCCAGAGTGCTGG + Intergenic
949857448 3:8474984-8475006 CAAATCCAAGGCCACAAGGCTGG + Intergenic
950284900 3:11736989-11737011 CAGTGCCCAGGCTGCAGTGCAGG + Intergenic
951708709 3:25568731-25568753 AGATTCCCAGGTCACAGTGGTGG + Intronic
951877687 3:27445374-27445396 CAGTTTCCAGGCCACAGCACAGG - Intronic
953065403 3:39465150-39465172 CAAATTCCTGGCCAAAGTGCTGG + Intergenic
953330849 3:42051855-42051877 CAATTCCCAGAATACAGTCCTGG + Intronic
953508712 3:43512915-43512937 AAGTCTCCAGGCCACAGTGCAGG + Intronic
955797584 3:62654062-62654084 AAATTTCAAGGCCACTGTGCAGG - Intronic
957411776 3:79850687-79850709 CTATTACCAGGCCAATGTGCTGG + Intergenic
957447830 3:80338323-80338345 CAGTTCTCAGGCCCCAGTGGTGG + Intergenic
958266832 3:91447482-91447504 CCAATCATAGGCCACAGTGCAGG + Intergenic
958806300 3:98814956-98814978 GAGTTTCCAGGCCACAGTGCAGG + Intronic
960014462 3:112871377-112871399 CAATTCTCAGGCCTCATTGGTGG + Intergenic
961497927 3:127307564-127307586 CAAGTCCGAGGCCTCAGTGTTGG - Intergenic
961665775 3:128492551-128492573 CAATCCCCAGGCCACCGCGGCGG - Intronic
962054785 3:131859556-131859578 CAACACCCAGGCCACACTCCAGG + Intronic
962640895 3:137385368-137385390 GAAGTCCAAGGCCAAAGTGCTGG + Intergenic
962717759 3:138141915-138141937 CAATTTCTAGGCCACAGTACAGG + Intergenic
962777166 3:138672655-138672677 CATCTCCCAGGTCAAAGTGCTGG - Intronic
962823746 3:139080070-139080092 CATTGCCTAGGCCAGAGTGCAGG - Intronic
963233749 3:142935592-142935614 CAACTCCCAGGCCACACAGCAGG + Intergenic
964629889 3:158799146-158799168 CAATTTCTAGGCCACACTGCTGG + Intronic
964862003 3:161213069-161213091 CAATTCCCAGGCAACTTTCCAGG - Intronic
966282306 3:178246180-178246202 GAAATCCAAGGGCACAGTGCTGG + Intergenic
968438125 4:606013-606035 CAACCCCCAGGCCACACAGCAGG + Intergenic
969314349 4:6372496-6372518 CACTGGCCAGGCCACAGTGAAGG + Intronic
970917040 4:21348069-21348091 CACTTTCCAGGCCACACAGCTGG - Intronic
971290825 4:25337543-25337565 CATCTGCCAGGCCACAGTGATGG - Intronic
972837931 4:42896625-42896647 CTATTTCCAGGCCACAGTCATGG - Intronic
974148335 4:57973467-57973489 GAATTCCCATTCCACAGTGGGGG - Intergenic
974994640 4:69139862-69139884 CAATGCCCAGGCTGTAGTGCAGG + Intronic
975495976 4:75036398-75036420 ACATGCCCAGGTCACAGTGCTGG - Intronic
975798973 4:78038857-78038879 GAGTTTCCAGGCCACAGCGCAGG + Intergenic
975936524 4:79587957-79587979 CATTTACCTGGTCACAGTGCTGG - Intergenic
976402864 4:84626763-84626785 TAATTCCCAGAGCGCAGTGCAGG + Intronic
977589167 4:98807510-98807532 CAAGTCCAAGACCACGGTGCTGG - Intergenic
978174294 4:105710266-105710288 CCATCCCCAGGCGACAGAGCAGG - Intronic
978824867 4:113009977-113009999 TAATTCCCAAACCAAAGTGCTGG - Intronic
980272759 4:130607996-130608018 CAAATCACTGGCCAAAGTGCTGG - Intergenic
984747618 4:183238342-183238364 CACATGCCAGCCCACAGTGCTGG + Intronic
985222126 4:187718129-187718151 CAATTCTCAGGCCCACGTGCAGG + Intergenic
986963065 5:13238903-13238925 CATTTCCAAGGCCACATGGCAGG - Intergenic
988857261 5:35240397-35240419 AAATTCCAAGGCCCCATTGCAGG + Intergenic
990259788 5:54009906-54009928 CAATTCTCAGGCCACCCTGGAGG + Intronic
990798797 5:59575689-59575711 AAATTCCCAGGACACAATTCTGG + Intronic
991665570 5:68996336-68996358 CAACCCCCAGGCCACACAGCAGG + Intergenic
992520986 5:77551179-77551201 CAATTCACAGGGTACTGTGCAGG - Intronic
996143062 5:119938579-119938601 TAATTTACAGACCACAGTGCAGG - Intergenic
997259301 5:132453902-132453924 CAATGACCAGGCCATGGTGCTGG - Intronic
998479646 5:142452085-142452107 GAGTTTCCAGGCCATAGTGCAGG - Intergenic
999742387 5:154566147-154566169 CACCTCCCAGGGCACAGAGCTGG - Intergenic
999835967 5:155373064-155373086 CAATTTCCAAGCTACAGTACAGG - Intergenic
1001665947 5:173433876-173433898 TAATTCCCACTCCACAGTGGAGG + Intergenic
1001936850 5:175711617-175711639 TAGTTCCCAGGCCCCAGTCCTGG - Intergenic
1002352678 5:178594148-178594170 GATTTTCCAGGACACAGTGCAGG + Intergenic
1002573204 5:180155778-180155800 CACTCCCCAAGCCACAGTGAAGG + Intronic
1003031165 6:2602341-2602363 CAATTGCCCGGGCACAGTGGTGG - Intergenic
1003409952 6:5853239-5853261 GAAATCCAAGACCACAGTGCTGG - Intergenic
1004319861 6:14623977-14623999 CAATGAACAGACCACAGTGCTGG - Intergenic
1006098098 6:31668773-31668795 CAATTCCCAGGCCCAAGTTCTGG - Intronic
1006423433 6:33949448-33949470 CAAGTCCCAAGCCAAAGTCCTGG - Intergenic
1006921777 6:37632370-37632392 CACTGTCCAGGCCACAGAGCAGG + Exonic
1007606949 6:43124134-43124156 CCTTTCCCAGACCACAGTCCTGG + Intronic
1008988378 6:57574114-57574136 CCAATCATAGGCCACAGTGCAGG - Intronic
1009176990 6:60472703-60472725 CCAATCATAGGCCACAGTGCAGG - Intergenic
1011962369 6:93106763-93106785 CACTTCCAAGGCCACAGTCTTGG - Intergenic
1017869558 6:158475268-158475290 CAAACTCTAGGCCACAGTGCTGG - Intronic
1019013698 6:168863938-168863960 CAATTCCCAGTCCCCACTCCAGG + Intergenic
1019170520 6:170130934-170130956 CAGATCCCGGGGCACAGTGCTGG - Intergenic
1019288030 7:233484-233506 CTCTTCCCAGCCCAGAGTGCAGG + Intronic
1021036474 7:15805984-15806006 CAATTTCCAGGCCTCAGGGTAGG - Intergenic
1022009079 7:26292940-26292962 CAGTTCCCAGGCCCCAGAGGTGG - Intronic
1029493963 7:100887303-100887325 CTGTTCCCAAACCACAGTGCTGG + Exonic
1029736685 7:102469245-102469267 AAACTCCGAGGCCACAGAGCAGG - Intronic
1030397602 7:109006894-109006916 CAATCCTAAGGCCACATTGCAGG + Intergenic
1030465089 7:109890836-109890858 AAATTCCCAGGCTAGAGTCCAGG + Intergenic
1030499930 7:110347381-110347403 AAGTTCCCAGGCCACAGTTCTGG + Intergenic
1030514278 7:110520458-110520480 AGACTCCCAGGCCACAGTGTTGG - Intergenic
1030706983 7:112702949-112702971 TATTGCCCAGGCTACAGTGCAGG - Intergenic
1031303250 7:120090272-120090294 TAATTTACAGGCCATAGTGCAGG - Intergenic
1032006461 7:128305785-128305807 CAAGGCCCAGACCACAATGCAGG + Exonic
1032028144 7:128459839-128459861 CAATTCCTGTGCTACAGTGCGGG - Intergenic
1032865400 7:135919506-135919528 CACTTCTCAGGCCACCCTGCAGG + Intergenic
1035062927 7:156082346-156082368 GAGTTCCTAGGCCACAGTGTTGG - Intergenic
1036782720 8:11660513-11660535 CAACTCCCAGGCTTCAGAGCTGG - Intergenic
1037542977 8:19889866-19889888 CAAATCCCAGGGCATAGGGCTGG + Intergenic
1038053743 8:23838073-23838095 AAATTCCCAGGCAACACTGAGGG + Intergenic
1038308205 8:26423543-26423565 CAATTATGATGCCACAGTGCAGG - Intronic
1038992686 8:32886250-32886272 GAATTCCCAGGACAGAATGCAGG - Intergenic
1039998587 8:42557197-42557219 CATTTCCCAGTCCACAGCTCAGG + Intergenic
1041331318 8:56728730-56728752 CACTTCACAGGCCACAATGCAGG + Intergenic
1041799456 8:61783494-61783516 CAATTACCAGACCACAGAGAAGG + Intergenic
1045354857 8:101376579-101376601 CAACACTCAGGCCACAGTGTGGG - Intergenic
1047907124 8:129484173-129484195 CAGTTTCCAGGCCACAGCACAGG + Intergenic
1049245301 8:141559262-141559284 CAGTACCCACCCCACAGTGCTGG + Intergenic
1052825070 9:33168064-33168086 TAACTCCCAGGCCAGCGTGCAGG + Intergenic
1053482764 9:38428227-38428249 CACTTTCCAGGCCACTCTGCAGG + Intergenic
1054342334 9:63877369-63877391 CAAACCCCTGGCCACACTGCTGG + Intergenic
1055530600 9:77178772-77178794 AATTTCCCAGGCCAAAGTGAGGG + Intronic
1057274070 9:93667015-93667037 CAACTCCCAGGCCACTTTGGTGG + Intronic
1057325310 9:94058076-94058098 CAGTTTCCAGGCTTCAGTGCAGG + Intronic
1058562363 9:106243380-106243402 CAATTCCCAGGTCAAACTGGGGG + Intergenic
1059533847 9:115062994-115063016 GAAATCCCAGGCCTCAGGGCTGG - Exonic
1059560943 9:115333870-115333892 TAATTCCCTGGGCACAGTCCAGG - Intronic
1059935453 9:119305840-119305862 CTATCCCCAGGAAACAGTGCAGG + Intronic
1059994245 9:119893552-119893574 CAACTCTCAGGGCACAGAGCAGG - Intergenic
1061119367 9:128633830-128633852 CGATGCCCAGGGCACAGTGAAGG - Exonic
1061534293 9:131238207-131238229 CACTGCCCGGGCCCCAGTGCTGG - Intergenic
1061991730 9:134163142-134163164 CACATCCCAGGCCTCAGTGCCGG + Intergenic
1062023964 9:134332020-134332042 CCAGTCCCAGGGCACAGAGCTGG - Intronic
1062048351 9:134434709-134434731 CATTTCTGAGTCCACAGTGCTGG + Intronic
1062357076 9:136170101-136170123 CAATGCTCTGGCCACAGTGCCGG - Intergenic
1062537438 9:137027180-137027202 CACCTCCCAGGCCACAGGCCTGG - Intronic
1186149561 X:6660039-6660061 TAATTCCCAGAGCACAATGCTGG + Intergenic
1194885640 X:99313143-99313165 GAATTTCCAGGCTGCAGTGCAGG + Intergenic
1194977163 X:100407700-100407722 CAGTGACCAGGCCACTGTGCGGG + Exonic
1195067986 X:101254705-101254727 TACTTCTCAGGCCAGAGTGCAGG - Intronic
1196906510 X:120442190-120442212 CTATGCCCAGGCCAGATTGCAGG - Intronic
1200046961 X:153408344-153408366 CAATGCCCAGGCCTCAGGGCAGG - Intergenic