ID: 1062776089

View in Genome Browser
Species Human (GRCh38)
Location 10:149244-149266
Sequence GTGGCCTGGGAATTGCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062776081_1062776089 2 Left 1062776081 10:149219-149241 CCCTTTGGATCTCCATCCCTGCA No data
Right 1062776089 10:149244-149266 GTGGCCTGGGAATTGCTGTGAGG No data
1062776080_1062776089 11 Left 1062776080 10:149210-149232 CCACACACTCCCTTTGGATCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1062776089 10:149244-149266 GTGGCCTGGGAATTGCTGTGAGG No data
1062776078_1062776089 27 Left 1062776078 10:149194-149216 CCTCAGCTCAGTGAGACCACACA No data
Right 1062776089 10:149244-149266 GTGGCCTGGGAATTGCTGTGAGG No data
1062776082_1062776089 1 Left 1062776082 10:149220-149242 CCTTTGGATCTCCATCCCTGCAC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1062776089 10:149244-149266 GTGGCCTGGGAATTGCTGTGAGG No data
1062776085_1062776089 -10 Left 1062776085 10:149231-149253 CCATCCCTGCACTGTGGCCTGGG 0: 1
1: 3
2: 9
3: 145
4: 1190
Right 1062776089 10:149244-149266 GTGGCCTGGGAATTGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062776089 Original CRISPR GTGGCCTGGGAATTGCTGTG AGG Intronic
No off target data available for this crispr