ID: 1062776091

View in Genome Browser
Species Human (GRCh38)
Location 10:149257-149279
Sequence TGCTGTGAGGCAGAACACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062776087_1062776091 -1 Left 1062776087 10:149235-149257 CCCTGCACTGTGGCCTGGGAATT 0: 1
1: 0
2: 10
3: 46
4: 335
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data
1062776080_1062776091 24 Left 1062776080 10:149210-149232 CCACACACTCCCTTTGGATCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data
1062776088_1062776091 -2 Left 1062776088 10:149236-149258 CCTGCACTGTGGCCTGGGAATTG 0: 1
1: 0
2: 1
3: 34
4: 315
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data
1062776082_1062776091 14 Left 1062776082 10:149220-149242 CCTTTGGATCTCCATCCCTGCAC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data
1062776085_1062776091 3 Left 1062776085 10:149231-149253 CCATCCCTGCACTGTGGCCTGGG 0: 1
1: 3
2: 9
3: 145
4: 1190
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data
1062776081_1062776091 15 Left 1062776081 10:149219-149241 CCCTTTGGATCTCCATCCCTGCA No data
Right 1062776091 10:149257-149279 TGCTGTGAGGCAGAACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062776091 Original CRISPR TGCTGTGAGGCAGAACACTG AGG Intronic
No off target data available for this crispr