ID: 1062779639

View in Genome Browser
Species Human (GRCh38)
Location 10:190370-190392
Sequence GAGGGTGTGCAGAAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 1, 2: 14, 3: 58, 4: 552}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062779639_1062779650 11 Left 1062779639 10:190370-190392 CCCTGCCTCTTCTGCACACCCTC 0: 1
1: 1
2: 14
3: 58
4: 552
Right 1062779650 10:190404-190426 CACTCTCCTTAGGCTCCGGCTGG No data
1062779639_1062779653 22 Left 1062779639 10:190370-190392 CCCTGCCTCTTCTGCACACCCTC 0: 1
1: 1
2: 14
3: 58
4: 552
Right 1062779653 10:190415-190437 GGCTCCGGCTGGGCTCTCGCAGG No data
1062779639_1062779646 7 Left 1062779639 10:190370-190392 CCCTGCCTCTTCTGCACACCCTC 0: 1
1: 1
2: 14
3: 58
4: 552
Right 1062779646 10:190400-190422 TCCCCACTCTCCTTAGGCTCCGG No data
1062779639_1062779645 1 Left 1062779639 10:190370-190392 CCCTGCCTCTTCTGCACACCCTC 0: 1
1: 1
2: 14
3: 58
4: 552
Right 1062779645 10:190394-190416 TGCAACTCCCCACTCTCCTTAGG No data
1062779639_1062779651 12 Left 1062779639 10:190370-190392 CCCTGCCTCTTCTGCACACCCTC 0: 1
1: 1
2: 14
3: 58
4: 552
Right 1062779651 10:190405-190427 ACTCTCCTTAGGCTCCGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062779639 Original CRISPR GAGGGTGTGCAGAAGAGGCA GGG (reversed) Intronic
900881392 1:5383691-5383713 GAGGGTGAGCAGTAGAGTCCAGG + Intergenic
901666449 1:10828830-10828852 GAGTTTGTCCAGGAGAGGCAGGG - Intergenic
902173173 1:14629540-14629562 GAGGGAGCAAAGAAGAGGCAGGG - Intronic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
902530582 1:17088136-17088158 TGGGGAGGGCAGAAGAGGCACGG + Intronic
902618356 1:17636097-17636119 GAGGGAGTGCAGTTGAGCCAGGG - Intronic
902654549 1:17858550-17858572 GAGGGTGACCAGAACTGGCAAGG + Intergenic
902768273 1:18631048-18631070 GAAGGCGTGGAGAAGAGGGAGGG + Exonic
902825760 1:18973137-18973159 GAGTGAGGGCAGAAGAGGAAGGG - Intergenic
902939969 1:19793944-19793966 GAGGGTTTGGAGCAGAGGAAGGG - Intronic
903337846 1:22636766-22636788 GAGGCTGGGCAGCTGAGGCAGGG + Intronic
903931264 1:26863814-26863836 GAGGGTGTGCAGATCAGCCATGG - Exonic
904207650 1:28865179-28865201 GAGGGAGAGGAGATGAGGCACGG - Intergenic
904386873 1:30148664-30148686 GAGGGTGGGCAGATGGAGCAGGG + Intergenic
904493938 1:30876527-30876549 GAGGGTGTTGAGAAGGGACAGGG - Intronic
904621904 1:31780937-31780959 GAGAGTTTCCAGAAGAGGCCAGG - Intergenic
904797126 1:33064948-33064970 TAGATTGTGAAGAAGAGGCAGGG + Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905008376 1:34729603-34729625 GAGGGTATGCAAAAGAGACTAGG + Intronic
905861837 1:41357319-41357341 GATGGTGTGCAGAATGGGCTTGG + Intergenic
906159479 1:43637155-43637177 GATGGGGTGCAGAATGGGCAGGG + Intergenic
906288278 1:44602693-44602715 GAGTGTGGGAAGAAGAGGAATGG - Intronic
906682315 1:47737190-47737212 CAGGGTGTGGAGAGGAGACATGG + Intergenic
906710571 1:47926805-47926827 AAGGGTGTGCTGGAGAGGAAGGG - Intronic
907328747 1:53657881-53657903 GAGGGTGCAGAGAAGGGGCAAGG - Intronic
907372903 1:54014471-54014493 GAGGGTGAGCAGAGCAGGGATGG + Intronic
907383807 1:54112577-54112599 ATGGGAGTGCAGAGGAGGCAGGG - Intergenic
907452999 1:54559236-54559258 GAGGGTGGGCAGAGGAGGCTGGG - Intronic
907464074 1:54623584-54623606 GAGGGTGTGGGGAAGAGGATTGG - Intronic
907663371 1:56413905-56413927 GAGGGTGTGAAGCAGAGGAAAGG - Intergenic
908252276 1:62274530-62274552 GAGGGAGGGCAGGAGGGGCAGGG + Exonic
908643538 1:66251696-66251718 GAGGAAGTGCAGGAGAGGCCAGG + Intronic
908680443 1:66655075-66655097 GTTGGTGTTGAGAAGAGGCATGG - Intronic
908774869 1:67630033-67630055 GAAGGTGTGCAGAAGCCACAGGG - Intergenic
909772052 1:79436046-79436068 GAGGGTGTGGGGAAGAAGAATGG + Intergenic
910487760 1:87734058-87734080 GAGGGTGGAAAGAAGAGACAAGG - Intergenic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
910963490 1:92785224-92785246 GACGGAGTGCAGAGGAGGCGGGG + Intronic
911375325 1:97044444-97044466 GAGGAGGTGCAGTGGAGGCAAGG + Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911563667 1:99436309-99436331 GAGGCTGTGCAGAGGAGCCTTGG + Intergenic
911777469 1:101832552-101832574 GTGGGTGTGGAGTAGGGGCAGGG + Intronic
912449140 1:109758820-109758842 GAGGGTAGGCAGATGAGGCAGGG - Intronic
913133334 1:115863225-115863247 GAGAGTGGGAAGGAGAGGCAGGG + Intergenic
915023724 1:152806444-152806466 GAGGATGTGCTCAGGAGGCAGGG - Intronic
915145242 1:153792945-153792967 GAGTTTGTGCTGAAGAGGCAAGG + Intergenic
916187358 1:162146089-162146111 CTGGGAGTGCAGCAGAGGCAGGG + Intronic
916828051 1:168462645-168462667 GAGGGAGTGCAGTAGAGAGATGG + Intergenic
917008549 1:170444585-170444607 CAGATTGTGCAGAAGAAGCAGGG - Intergenic
917477028 1:175377852-175377874 GATGCTGTGCAGAACAGTCATGG - Intronic
918073805 1:181153702-181153724 AGGAGTGTGCAAAAGAGGCAAGG + Intergenic
919803207 1:201365722-201365744 GAGGGTGTCCAGGACAGGCAGGG + Intronic
920589550 1:207203751-207203773 CAGAGTGTGCTGAAGTGGCAGGG + Intergenic
921448091 1:215270484-215270506 GAGGAGTTGCAGAAGAGCCAGGG - Intergenic
922237502 1:223733187-223733209 GGGGGAGTGCAGGAGAGGCTGGG - Intronic
922272092 1:224043674-224043696 GAGGGTGTGCTGAAGGGGAGGGG - Intergenic
922974630 1:229773856-229773878 GAGGATGTGGAGAAAAGGGAAGG + Intergenic
923168775 1:231393743-231393765 GAGGGTGTGATGAGGAAGCATGG - Intronic
923990320 1:239428920-239428942 GAGCCTGTGCAGAAGATGCAAGG + Intronic
924920060 1:248619482-248619504 CAGGGGCTGCAGAAGAGGGAGGG + Intergenic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1063010898 10:2020497-2020519 CAGGGTGTGCAGAGCAGGCCAGG - Intergenic
1063088126 10:2837538-2837560 GGGGGAGTGCTGAACAGGCAGGG - Intergenic
1063116656 10:3076523-3076545 GAGGGTGTGGAGGACAGGGAGGG - Intronic
1063226609 10:4020907-4020929 GAGGATGTGGAGAAAAGGGAGGG - Intergenic
1063727542 10:8655113-8655135 GAGGTTGTGGAGAAAAGGAAAGG + Intergenic
1063728046 10:8661461-8661483 GAGGATGTGGAGAAAAGGAAAGG + Intergenic
1063991962 10:11576266-11576288 GAGTGTACCCAGAAGAGGCATGG + Intronic
1065154209 10:22853010-22853032 GAGGATGTGCAGACGGGACAAGG + Intergenic
1065610051 10:27463831-27463853 GAGAGGGTGCAGAAGTGGCCAGG + Intergenic
1066205561 10:33186132-33186154 GAGGCTGTGCAAATGAGACATGG - Intronic
1067973023 10:50992651-50992673 TGGGGTGTGCAGAGGAGGCTGGG + Intronic
1068685892 10:59869678-59869700 GTGGGTGTGCAGAATGAGCACGG - Intronic
1069493825 10:68885024-68885046 GAGGGGGTTAAGAAAAGGCAGGG + Exonic
1069915277 10:71783302-71783324 GAGGGTGGAGAGAAGAGACAGGG - Intronic
1070328628 10:75403232-75403254 GAGGCTGCGAAGAAGAGGCCTGG + Intergenic
1070395217 10:76006271-76006293 GAGGGTGTTCAGAGGAGTGAGGG + Intronic
1070540613 10:77412672-77412694 AAGGGAGGGCAGAGGAGGCAGGG + Intronic
1070680937 10:78448548-78448570 GTGGGGGAGCAGGAGAGGCAGGG + Intergenic
1070828318 10:79403886-79403908 GGGGGTGTGGAGAGGAGGGAAGG + Intronic
1071573260 10:86709499-86709521 AAGGGTAGGCAGAAGAGGCCAGG + Intronic
1072721032 10:97781270-97781292 GAGGGTGTGGAGAAGCGGCATGG + Intergenic
1073047082 10:100645853-100645875 GAGTGTGTGCGGCAGGGGCAGGG - Intergenic
1073048459 10:100653629-100653651 GAGGGGGTGCAAAAGGGTCAGGG - Intergenic
1074267628 10:111920638-111920660 GAGGGTGTGAAGAGGAGGAAGGG - Intergenic
1074511114 10:114112865-114112887 GTGGTTGTGCACAAGAGGAAGGG + Intergenic
1074559118 10:114519448-114519470 GAGCGAGTGCAGATTAGGCAAGG + Intronic
1075091892 10:119448431-119448453 CAGGCAGTGCAGAAGAGGCGTGG + Intronic
1075102751 10:119517781-119517803 GAGGTGGGGCAGAAGAGGCCGGG + Intronic
1075213895 10:120515308-120515330 GAGTGTGAGGAGAAGAGGCAAGG - Intronic
1076891059 10:133283640-133283662 CACGGAGTGCAGGAGAGGCAGGG - Intronic
1076891071 10:133283693-133283715 CAGGGCGTGCGGGAGAGGCAGGG - Intronic
1076891076 10:133283711-133283733 CAGGGAGTGCGGGAGAGGCAGGG - Intronic
1076891081 10:133283729-133283751 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1076891089 10:133283766-133283788 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1076891099 10:133283801-133283823 CAGGAAGTGCAGGAGAGGCAGGG - Intronic
1078895525 11:15593897-15593919 GAGAGGGTGCAGAAGACACAGGG + Intergenic
1081268122 11:41052130-41052152 TAGGGTGTGCAGTGGATGCAAGG - Intronic
1082785965 11:57316843-57316865 AAGGGTTTGCAGGAGAGGCATGG - Intronic
1083287207 11:61667761-61667783 GAGGGTGGGCATAGGAGTCAGGG + Intergenic
1083731623 11:64655426-64655448 GAGGCTGGACAGAAGAGGAAGGG + Intronic
1083733066 11:64663581-64663603 GTGGGTGGGCAGAGCAGGCATGG - Intronic
1083850576 11:65364019-65364041 GAGGGTGTTCATTAGAGGCTTGG - Intergenic
1083892020 11:65600184-65600206 GTGGGTGGGCAGAAGGGGCAGGG - Intronic
1083952346 11:65963864-65963886 GAAGGTGCACAGAAGAGGCAGGG + Intronic
1084009673 11:66340560-66340582 GAGCAGGGGCAGAAGAGGCAGGG + Intronic
1084032430 11:66488764-66488786 GAGGATGTGGAGATGAAGCAGGG - Intronic
1084086697 11:66858244-66858266 GAGGGTGTGCAGGGCAGGCATGG - Exonic
1084517697 11:69645427-69645449 AAGGGTGTGCAGTAGTGGGAAGG - Intronic
1084945355 11:72635264-72635286 GAGGGAGGACAGAAGAGGCTGGG - Intronic
1084953682 11:72680182-72680204 GAGGCTGGGCACAGGAGGCAGGG + Intergenic
1085341230 11:75732872-75732894 GAGGGAGTGCACTAGAGGCAGGG - Intronic
1085349050 11:75786591-75786613 GAGGGTGTTGAGAAGATGCTGGG - Intronic
1085525070 11:77159390-77159412 GAGGGTGGGCAACAGGGGCAAGG - Intronic
1085809024 11:79663663-79663685 GAGGGTCTTCAGAAAAAGCATGG + Intergenic
1085819563 11:79777704-79777726 TAGGGTGTGCAATAGAGGCTTGG - Intergenic
1085829083 11:79880523-79880545 GTGGGGGTGCAGAATGGGCATGG + Intergenic
1085873509 11:80379253-80379275 GACTGTGAGCAGAAGAGTCATGG + Intergenic
1085976826 11:81665913-81665935 GAGTGTGTAGAGGAGAGGCAGGG + Intergenic
1086913133 11:92496334-92496356 GAGGGTGCGGTGGAGAGGCAGGG - Intronic
1088191024 11:107228375-107228397 GAGGGAGTACAGGAGAAGCAGGG - Intergenic
1088751824 11:112848587-112848609 GAGGCTGGGCAGAAAAGGAAGGG + Intergenic
1088871576 11:113894654-113894676 GAGGGAGTGCAGAAGAGGAACGG - Intergenic
1088945992 11:114513006-114513028 GTGGGTGAGCAGCAGAGACAGGG + Intergenic
1089149972 11:116356988-116357010 GGGAGTGTGCAGAGGAGGCGAGG + Intergenic
1089200825 11:116723840-116723862 GAGGGTGGGCAGGAGAGGAGAGG - Intergenic
1089559781 11:119338021-119338043 GAGGCTGTGCAGATGGGGCTGGG + Intergenic
1089678494 11:120106422-120106444 CAGGATGTGCAGAGGATGCAGGG - Intergenic
1089752159 11:120659684-120659706 ATGGGTGAGCAGAAGAGGAAGGG - Intronic
1090015713 11:123084769-123084791 GATGGTGTGAAGAAGAGGAAAGG + Intronic
1090172063 11:124613829-124613851 GAGGATGGGGAGAGGAGGCAGGG - Intronic
1090277560 11:125430528-125430550 GAGGGTGTGATGGAGAGGCTGGG - Intronic
1090827453 11:130397746-130397768 GAGGGCATGCAGAGGAGGCCAGG + Intergenic
1090940035 11:131379329-131379351 GAGGATGGGAAGAAGAGGCAGGG + Intronic
1091072330 11:132579514-132579536 GGGGGTGTGCAGAAATGCCAAGG + Intronic
1091332929 11:134744678-134744700 GAGGGGGTAGAGAAGAGGCAAGG + Intergenic
1091386418 12:98856-98878 GAGGGCGTGCAGAAGTAGGAAGG + Intronic
1091409017 12:227054-227076 GATGGTGTGAAAAAGGGGCAAGG + Intronic
1092091713 12:5809129-5809151 GAGGGAGTGCAGATGGGGGAAGG + Intronic
1093906897 12:24703796-24703818 GAGAGTGGACAGAAGAGGTAAGG - Intergenic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1094865157 12:34523098-34523120 GAGAGTGTGAGAAAGAGGCATGG - Intergenic
1096357896 12:50957976-50957998 GTGTGTGTGTAGTAGAGGCAGGG + Intronic
1096652196 12:53067372-53067394 GAGGGTCTGCAGGAAGGGCACGG + Intronic
1099093330 12:78340511-78340533 GACGCTGTGCACAAGAGACATGG - Intergenic
1101364621 12:104060289-104060311 GAGAGTTTGGAGAAGAGGGATGG - Intronic
1101809872 12:108098444-108098466 GAGTGTGGGCAGATGGGGCAGGG - Intergenic
1102123766 12:110463824-110463846 GAGGGTTTTAAGAAGAGGAAAGG - Intronic
1102487432 12:113267811-113267833 GAGGGTGTGGAGATGTGTCATGG - Intronic
1103451314 12:121031379-121031401 GAGGGTGAGGAGGAAAGGCAGGG - Intronic
1104627087 12:130366375-130366397 GAGGGAGGGCAGAAGGGCCAGGG + Intronic
1104667202 12:130656073-130656095 GAGGGTGGGGAGAAGGGACATGG + Intronic
1105511623 13:21056626-21056648 GGAGGGGTGCAGAGGAGGCAAGG - Intronic
1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG + Intergenic
1106415265 13:29541007-29541029 GAGTGTGCACAGAAGGGGCAGGG + Intronic
1106415654 13:29543794-29543816 GAGGGGGTGGAGAGGAGGCAAGG + Intronic
1106650785 13:31688075-31688097 GAGGGTGAGCAGAAGAGGGTGGG + Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107602220 13:42025097-42025119 GAGGTTGGGCAGAAGAGGAGAGG + Intergenic
1110255928 13:73433957-73433979 GAGGGGGAGGAGAAGAGGGAGGG + Intergenic
1110555130 13:76851357-76851379 AAGAGTGAGCAGAAGATGCAAGG - Intergenic
1110708754 13:78626707-78626729 GAGGGGCTAGAGAAGAGGCAAGG + Intronic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111146690 13:84191230-84191252 GAGGATGTACAGAAGTGACAAGG + Intergenic
1114524623 14:23359961-23359983 GAGGGTGGGAAAAGGAGGCAGGG + Exonic
1114775164 14:25473436-25473458 GAGGGTCTAAAGAAGAGGAAAGG + Intergenic
1115260208 14:31444429-31444451 GATGGTCTGCAGAAAAGGAATGG + Intronic
1115797014 14:36949538-36949560 GAGGAAGTGCAGAGGAGGCAGGG - Intronic
1115885149 14:37962979-37963001 GAGGGTGGGGAGGAGAGGTAAGG - Intronic
1115996843 14:39203764-39203786 GAGAGTGGGCAGAAGAGTGAGGG + Intergenic
1116123970 14:40757697-40757719 GAGGATGTTCAGAAGTTGCAGGG - Intergenic
1116390374 14:44384128-44384150 GATGGGGTGGAGAAGAGGAAAGG + Intergenic
1116390920 14:44388351-44388373 GATGGGGTGGAGAAGAGGAAAGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117292116 14:54344314-54344336 GAGGTTGTGCAGGAGAGGGCTGG + Intergenic
1117513269 14:56473774-56473796 GAGGGGGTGGAGAGGAGGCATGG - Intergenic
1117670568 14:58101806-58101828 GAGGGTGTGGAGAGGAGGGCAGG + Intronic
1118321639 14:64756944-64756966 GAGGAAGAGCAGGAGAGGCAGGG + Intronic
1118322303 14:64760267-64760289 GAGGATGTGCACAACAGGCCAGG + Intronic
1118416098 14:65538289-65538311 GAGGGTGAGTTGAACAGGCAAGG - Intronic
1118567178 14:67154311-67154333 GAGGGTGTGGGGAATAGGAAAGG - Intronic
1118756731 14:68850355-68850377 GATGCTGTGCAGGTGAGGCAGGG - Intergenic
1118934949 14:70279178-70279200 GAGGGAAAGAAGAAGAGGCAAGG + Intergenic
1118947309 14:70399406-70399428 GAGAGTGTGGGGAGGAGGCAGGG - Intronic
1119002359 14:70894110-70894132 GGGGGAGGGCAGCAGAGGCAGGG - Intergenic
1119842601 14:77804579-77804601 GAGGGGGTTCAGGGGAGGCAGGG + Intronic
1120676800 14:87430115-87430137 GAGAGTGTGCAAAAGAATCAAGG + Intergenic
1120762593 14:88298936-88298958 GAGGGTGTTCAGCAGAGGGAAGG - Intronic
1120848353 14:89146549-89146571 GAGGTGGAGCAGGAGAGGCATGG - Intronic
1121006970 14:90496593-90496615 GAGGGTGCGCAGCAGGAGCAGGG - Intergenic
1121395164 14:93615371-93615393 GAGGGTGGGGAGAAGAGGGAGGG - Intronic
1121406716 14:93723418-93723440 GAGTGAGTTCAGAGGAGGCAGGG + Intronic
1122043588 14:99007700-99007722 GAGGGTGAGGGGATGAGGCAGGG + Intergenic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1122338136 14:101007221-101007243 GGGGGTGGGCAGCTGAGGCAAGG - Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124685962 15:31782264-31782286 GAGGGTGTGCAGGAGCAGCTGGG + Intronic
1124957637 15:34369918-34369940 GAGGGGGAGAAGAAGAGGCCTGG + Intergenic
1125542073 15:40475364-40475386 GAGGGTGTGAGGAAGAGGAGAGG + Intergenic
1125731841 15:41896801-41896823 GAGGGTAGGCAGCAGAGGCCAGG - Exonic
1125733588 15:41908369-41908391 AAGGTCGGGCAGAAGAGGCAAGG - Intronic
1125884404 15:43217970-43217992 GAAAGTGTGCAGAGGAGGGAAGG + Intronic
1126254222 15:46606134-46606156 GAGCGTGGAGAGAAGAGGCAAGG + Intergenic
1126373131 15:47967815-47967837 GAGGGAGTGAAGAGGAGGTAGGG - Intergenic
1126385634 15:48090599-48090621 GAGGGAGAGAAGAAGGGGCAGGG + Intergenic
1127225727 15:56926439-56926461 GAGGCTGTGCTGAAGAGTCAGGG + Intronic
1127899414 15:63330004-63330026 GAGGGTTAGCAGAGCAGGCAGGG + Intronic
1128300747 15:66564981-66565003 GAGTGTGAGCACATGAGGCACGG + Intronic
1128582049 15:68817733-68817755 GAGGCTGTGCTGGAGAGTCACGG - Intronic
1128997404 15:72306999-72307021 AAGCGGGTGCAGGAGAGGCAGGG + Intronic
1129396096 15:75247853-75247875 GACGTTGTGCATAAGAGACATGG + Intergenic
1129689279 15:77704268-77704290 GAGGGAGTGTGGATGAGGCAGGG + Intronic
1130723808 15:86417705-86417727 GTGTGTGTGCAGTAGAAGCAGGG + Intronic
1130872571 15:87982925-87982947 GAGTGTAGGCAGAAGATGCAGGG - Intronic
1131458206 15:92599588-92599610 GAGGGTGTGTAGAAATGGGATGG + Intergenic
1132049629 15:98596367-98596389 GGTGGTTTGCAGATGAGGCAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132270248 15:100517811-100517833 GAGCGTTTACAGGAGAGGCAGGG + Intronic
1132325355 15:100964245-100964267 GGGGGTGTGCAGAGGAGGGAGGG - Intronic
1132771393 16:1565427-1565449 GAAGGTGTGTGGGAGAGGCAGGG + Intronic
1133270532 16:4609062-4609084 GAGGGGGTGGGGAGGAGGCAGGG + Exonic
1133288116 16:4700466-4700488 CTGTGTGGGCAGAAGAGGCACGG - Intronic
1134089762 16:11385192-11385214 GCAGGTGAGCAGGAGAGGCATGG - Exonic
1134290708 16:12901542-12901564 GAGGGCGGGCAGAGGAGGCGCGG - Intergenic
1134755719 16:16665580-16665602 GTGTGTGTGTATAAGAGGCAGGG + Intergenic
1134990347 16:18693585-18693607 GTGTGTGTGTATAAGAGGCAGGG - Intergenic
1135324132 16:21515277-21515299 CAGGGTGTGAAGGAGAGGCTCGG - Intergenic
1135743362 16:24995639-24995661 CAGGGTGGGCAGGAGAGCCAAGG + Intronic
1136025547 16:27465953-27465975 TAGGGTGTGTAGAAGGGGCCTGG - Intronic
1136335612 16:29608549-29608571 CAGGGTGTGAAGGAGAGGCTGGG - Intergenic
1137411563 16:48232685-48232707 GAAAGTGTGCAGCAGAGCCAGGG + Intronic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1138230845 16:55335020-55335042 GAGGGTGGGGAGAGGAGGCATGG - Intergenic
1138276454 16:55738361-55738383 GAGGCTGTGCAGTTCAGGCAGGG - Intergenic
1138282384 16:55781724-55781746 GAGGCTGTGCAGTTCAGGCAGGG - Intergenic
1138286564 16:55814920-55814942 GAGGCTGTGCAGTTCAGGCAGGG + Intronic
1139029883 16:62867256-62867278 GAAGGTCTGGAGAAGTGGCAGGG - Intergenic
1140111393 16:72008548-72008570 GAGGGCGGGCGGAAGAGGCGTGG + Intergenic
1140865526 16:79057714-79057736 GAGGGAGCTCAGAATAGGCAAGG + Intronic
1141002135 16:80317974-80317996 GAGGCACTGCAGAAGAGGAAGGG + Intergenic
1141012465 16:80415722-80415744 GAGGGTGCAGAGAGGAGGCATGG - Intergenic
1142036340 16:87864385-87864407 CAGGGTGTGAAGGAGAGGCCGGG - Intronic
1142135877 16:88451891-88451913 GCGGGTGGGTAGGAGAGGCAGGG - Intergenic
1142225936 16:88877686-88877708 GAGGGGGTGCAGCAGAGGCAGGG - Intronic
1143223545 17:5281995-5282017 GAGGGGCTGCAGCAGAGGCCTGG - Intergenic
1143255440 17:5554185-5554207 GAGGGTCTGCAGGAGAGGGATGG + Intronic
1143775241 17:9195080-9195102 GAGGGGGTGGGGAAGAGGCCAGG - Intronic
1143809151 17:9456344-9456366 GAGGCAGTGAAGAAAAGGCATGG + Intronic
1143851597 17:9816954-9816976 GTGGGTTTGCAGAAGTGCCAAGG + Intronic
1144300104 17:13915504-13915526 GAGGGAGAGGAGAAGAGGCCTGG - Intergenic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1145162172 17:20583079-20583101 GTGGGTGAGCAGCAGAGGCCAGG - Intergenic
1146279908 17:31538245-31538267 GAGGGTGGGCAGAAGAGGCCTGG + Intergenic
1146597336 17:34181588-34181610 GAGGCTGTGCAGGTGGGGCAGGG + Intergenic
1146624964 17:34428135-34428157 GAGTGTGAGCAGAATAGGGATGG - Intergenic
1146832593 17:36082563-36082585 GAGTGTGAGCAGAAGAGGATAGG + Intergenic
1146948445 17:36889960-36889982 GAGGGAGGGAAGAAGAGGCCTGG - Intergenic
1147139477 17:38453336-38453358 TAGGGTGTGCAGCAGAGTGAGGG + Intronic
1147542782 17:41374843-41374865 GAGGGTCTGGAGAATAGGCCAGG + Intronic
1148194215 17:45701634-45701656 GGGGGTGTGGAGGAGAGGGAAGG - Intergenic
1148864063 17:50619477-50619499 GAGGGGGTGGGGAAGAGGGAAGG - Intronic
1149491095 17:57085592-57085614 GAGGGGGCGCAGACGAGGGAGGG - Intronic
1149505129 17:57187993-57188015 GAGTGTGCTCAGAAGATGCAAGG - Intergenic
1149526369 17:57359121-57359143 GAGAGAGTGCATAAGATGCAGGG - Intronic
1149891436 17:60392842-60392864 GAGAATGTGTACAAGAGGCATGG - Intronic
1150893059 17:69177011-69177033 GAGGATATGCAGAAGAGAGATGG - Intronic
1151055320 17:71023930-71023952 GTGGGAGTGCAGAAGGAGCACGG - Intergenic
1151360206 17:73584208-73584230 GAAGGTGTGCAGAGCAGGCGAGG - Intronic
1151604893 17:75130029-75130051 GAGGGGGTACACGAGAGGCAAGG - Exonic
1151759140 17:76090748-76090770 GAGTGTGTGCAGCAGAGGACAGG - Intronic
1151763717 17:76121730-76121752 GAGGGGGCGCTGAAGAGGGAGGG + Intergenic
1151953008 17:77365631-77365653 GAGCGGGTGCAGAAGAGGGAGGG + Intronic
1152521446 17:80859007-80859029 GAGGGTGGGCAGAGGAGGTCGGG + Intronic
1152588775 17:81200855-81200877 GAGGGTGGTCGGAACAGGCAGGG + Intronic
1153890088 18:9505357-9505379 TAGGGTGTGGAGAAGAGGCAGGG - Intronic
1154394584 18:13975370-13975392 GAAGTTGTGCAGCAGAGGAAAGG - Intergenic
1155390683 18:25333382-25333404 GAGGGTGGGCAGAAGGGCCAGGG + Intronic
1156330514 18:36117315-36117337 TTCAGTGTGCAGAAGAGGCATGG - Intronic
1156411014 18:36828635-36828657 GAGGGTGTGGAGGAGAAGGAAGG - Intronic
1156967607 18:43114261-43114283 TAGGGTGAGGAGAAGAGGTAGGG + Intronic
1157394012 18:47326840-47326862 GAAGGTGTTGAGGAGAGGCAGGG + Intergenic
1158382702 18:56951378-56951400 GAGGGTGTGAGGAAGAGGTACGG - Intronic
1158427372 18:57352363-57352385 GAGGGGGTGCAGGAGAGGGAGGG - Exonic
1158610523 18:58935538-58935560 GAAGATATGCAGAAGAGACAAGG - Intronic
1158850518 18:61491955-61491977 GAGTGTGTGGAGAAGAGGCTAGG - Intronic
1158990842 18:62866859-62866881 GGGTGTGTGCAGTAGAGGGATGG - Intronic
1159729972 18:72013920-72013942 GAGGGTGTGAAGGAGAGCAAGGG - Intergenic
1159901685 18:74053098-74053120 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1160051465 18:75438035-75438057 GAGGTTCTGCAGCAGAGGAATGG + Intergenic
1160169963 18:76544781-76544803 GGGCTGGTGCAGAAGAGGCAGGG + Intergenic
1160409553 18:78666669-78666691 TGGGGTGTGCAGGAGAGGAAGGG + Intergenic
1160936440 19:1598219-1598241 GAGGGAGAGCAGACGAGGCAGGG + Intronic
1161255499 19:3306810-3306832 GAGGGGGTGGAGAGGAGGCGGGG - Intergenic
1161801397 19:6418438-6418460 GAGGGGGTTCTGGAGAGGCACGG - Intronic
1161821449 19:6533299-6533321 GAGGGTTTGGGGAAGGGGCAGGG - Intronic
1162548969 19:11347943-11347965 GAGTGTGAGCAGGAGAGGCAGGG - Intronic
1162799631 19:13103418-13103440 GAGGGTGAGAGGAAGAGCCATGG + Intergenic
1163398134 19:17075927-17075949 GGGGCTGCGCAGAAGAGGGACGG + Intronic
1163435502 19:17292826-17292848 CAGGATCTGCAGAAGACGCAGGG + Exonic
1163862594 19:19750013-19750035 GAGGGAGTTCAGAAAATGCATGG - Intergenic
1163919833 19:20278036-20278058 TAGATTGTGAAGAAGAGGCAGGG + Intergenic
1164648223 19:29874110-29874132 GAGGGGGTGCAGAAAAGGGGAGG + Intergenic
1164901464 19:31929545-31929567 TAGGGTGTGGAGAACAGGCCTGG - Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165607053 19:37114708-37114730 TAGATTGTGAAGAAGAGGCAGGG - Intronic
1166047705 19:40239050-40239072 GTGTGTGTGCAGAATAAGCAGGG - Intronic
1167321898 19:48802022-48802044 GGGGCTGGGAAGAAGAGGCAGGG - Intronic
1167612474 19:50514082-50514104 GAGGGTGTGCTGCAGGGGAAAGG - Intronic
1167710246 19:51106027-51106049 GAGTGTTTGTAGAGGAGGCAAGG - Intronic
1167780707 19:51597111-51597133 GAGTGTGTGTGGAGGAGGCAAGG + Intergenic
1168406599 19:56113714-56113736 GAGGGACTGCTGAAGATGCACGG + Intronic
1168709727 19:58492075-58492097 GAGGGTGCTCTGAAAAGGCATGG - Intronic
925283196 2:2699154-2699176 GAGGATGGGCAGAAGATTCAGGG + Intergenic
925610134 2:5695909-5695931 ATGGGTGGGGAGAAGAGGCAGGG - Exonic
925880181 2:8345746-8345768 CAGGGTGCCCAGAGGAGGCATGG - Intergenic
926123437 2:10257006-10257028 GAGGGTGGCAAGGAGAGGCACGG - Intergenic
926442188 2:12901449-12901471 GAGGCTGAGCAGAACATGCATGG + Intergenic
927092149 2:19720197-19720219 GTGGGTGTGCAGGAGAGTCCAGG + Intergenic
928032391 2:27792639-27792661 GAGGGTGTGCAAAAGAGCAAGGG - Intronic
928200371 2:29244163-29244185 GAGGGTGTGCCGGAAAGGAATGG - Intronic
929314342 2:40459458-40459480 CAGGGTCAGCAGCAGAGGCATGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
930692369 2:54377753-54377775 GAGAGTGTGTAGATGAGGAAAGG + Intronic
930717799 2:54609076-54609098 AAGGGGAGGCAGAAGAGGCAGGG + Intronic
932090447 2:68801289-68801311 GAAAGTGTGCAGATGAGGGAGGG + Intronic
932284689 2:70522278-70522300 GAGGGTGTACAGATGGGGAATGG + Intronic
932371529 2:71193064-71193086 GAGGTTGTGGAGAAAAGGGAAGG - Intronic
932461389 2:71884059-71884081 GAGACAGTGAAGAAGAGGCAGGG + Intergenic
932980208 2:76654313-76654335 TAGGGGCTGAAGAAGAGGCAGGG - Intergenic
933328185 2:80864552-80864574 GAGGAAGAGGAGAAGAGGCAGGG - Intergenic
935028584 2:99301027-99301049 GTGAGTGTGAAGCAGAGGCATGG - Intronic
935029402 2:99307480-99307502 GTGAGTGTGAAGCAGAGGCATGG + Intronic
935788170 2:106567920-106567942 AAGGGTGGGCAGAAATGGCACGG - Intergenic
935836626 2:107062212-107062234 GAATGTGTGCAGAAGAGGCAAGG + Intergenic
937670582 2:124533517-124533539 GTGGGTGTGGAGGAGAGGGATGG + Intronic
938149607 2:128870797-128870819 GAGGATGAGGAGAAGAGTCATGG + Intergenic
938318754 2:130347986-130348008 GTCAGTGTGCAAAAGAGGCAGGG + Intergenic
939085638 2:137715785-137715807 GGAGGTGTGGAGGAGAGGCATGG + Intergenic
939928856 2:148207113-148207135 AAGGATGTGCAGGAGGGGCAAGG + Intronic
940042875 2:149378623-149378645 GAGAGTTTGCAGAAGATGAAAGG + Intronic
942525588 2:176849469-176849491 GAGAGTGTGGAGGTGAGGCAGGG - Intergenic
942553953 2:177151911-177151933 AAGGCTGTGGGGAAGAGGCATGG - Intergenic
943892733 2:193311057-193311079 TTTGGAGTGCAGAAGAGGCAGGG + Intergenic
944175212 2:196821198-196821220 TAGGGTGTCCAGAGGTGGCATGG + Intergenic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
945178207 2:207064764-207064786 GGGGGGCTGCAGAAGAGGAAGGG + Intergenic
945749735 2:213766675-213766697 GATGGGGAGCAGAAGAGGCTAGG + Intronic
946253184 2:218425871-218425893 GGGGCTGAGCTGAAGAGGCAGGG + Intronic
946649099 2:221871894-221871916 GAGGGTGTGCAGAAGCAGAGTGG + Intergenic
947190967 2:227504152-227504174 GAGGGGAGGCGGAAGAGGCAGGG + Intronic
947544874 2:231003455-231003477 GAGGGAGGCAAGAAGAGGCAAGG + Intronic
948662451 2:239515672-239515694 GTGGGTGTGCAGAATGAGCAGGG - Intergenic
948740566 2:240043324-240043346 GAGGATGTGCAGATGAGTGAAGG - Intergenic
948887523 2:240891613-240891635 GAGGGGGTGCAGCAGATGCCCGG - Exonic
1169746156 20:8945241-8945263 GAGGGTGTGCTGATGATGGAAGG + Intronic
1169798979 20:9495924-9495946 GAGTGATTGCAGAAGAGGCAAGG + Intergenic
1171128372 20:22624686-22624708 GAGGAGGTGCAGCAGAGACAGGG - Intergenic
1171878142 20:30597554-30597576 GAGGGTGTGGACATGGGGCATGG - Intergenic
1172134526 20:32678072-32678094 AAGGGTGTGGAGGGGAGGCAGGG - Intergenic
1172391597 20:34568816-34568838 GAGGGTCTGCAGTACAGGGAGGG + Intronic
1172800347 20:37571976-37571998 GAGGGGCTGCAGAACAGGGAAGG + Intergenic
1173384076 20:42572363-42572385 GAGGGTGGCCAGCAGAGGCCAGG - Intronic
1173465028 20:43274027-43274049 GAGGGTTGGAAGAAGAGGGAGGG + Intergenic
1174759798 20:53195825-53195847 GAGGGAGGGCAGAAGAGAGAAGG - Intronic
1174806482 20:53608221-53608243 GAGGGTGTTCAGAGCAGGAAAGG + Intronic
1175186840 20:57184470-57184492 GAGGGTGTGTTCAAGGGGCAGGG + Intronic
1175247637 20:57591332-57591354 GAGCGTGTGAAGAAGTGGGAAGG + Intergenic
1175315525 20:58044170-58044192 GAGGGTGTGCAGCAGAGGGAGGG + Intergenic
1176159902 20:63642588-63642610 CAGGGTGTGCAGTGGCGGCAGGG - Intronic
1179109771 21:38436500-38436522 GAGGGAGTGAAGAAGAGTCCAGG + Intronic
1179144939 21:38759767-38759789 GAGGCTGTGGAGACCAGGCAGGG + Intergenic
1179300497 21:40104779-40104801 GAGGCTGTGCAGTAGGGGCAGGG + Intronic
1179480124 21:41671683-41671705 GGGGGTTTGGAGAGGAGGCAGGG + Intergenic
1179627453 21:42656722-42656744 GAGGTTGTGCAGAGGAAGCTGGG + Intronic
1180663855 22:17493850-17493872 GAGGATGTGCAGAAGATGCTGGG - Intronic
1180800085 22:18627663-18627685 GAGGGCGGGCACAAGGGGCAGGG - Intergenic
1180800098 22:18627693-18627715 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1180851331 22:19023258-19023280 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG + Intergenic
1181221630 22:21367603-21367625 GAGGGTGGGCACAAGGGGCAGGG + Intergenic
1181534350 22:23533995-23534017 GAGGGTGGGGAGATGAGGAAGGG + Intergenic
1181535308 22:23539199-23539221 CAGATTGTGAAGAAGAGGCAGGG + Intergenic
1181668738 22:24415777-24415799 GAGGGTGGGCACAGGGGGCATGG - Exonic
1181711580 22:24694986-24695008 GAGGCTGTGAAAAAGAAGCAGGG + Intergenic
1181775971 22:25160526-25160548 GAGGGAGAGCAGAAGAGGAGAGG - Intronic
1182128939 22:27836545-27836567 GAGGGTGGGCCGAAGCGGGAGGG - Intergenic
1182148404 22:28011742-28011764 GAAGGTAAGGAGAAGAGGCAAGG + Intronic
1182304604 22:29359146-29359168 GATGGTGTGCAGAGCTGGCATGG - Intronic
1182432862 22:30310870-30310892 GAGGGTGATAAGAAGAGGGAAGG - Intronic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182838365 22:33363142-33363164 GAGGGAGACCAGGAGAGGCAGGG + Intronic
1183271699 22:36866319-36866341 GGGGGTGTGAAGATGAGGCTTGG - Intronic
1183673524 22:39287089-39287111 AAGCATGTGCAGAAGAGACAAGG + Intergenic
1183676333 22:39300802-39300824 GAGGGTGTGCAGCAGAGGCAGGG + Intergenic
1183729293 22:39608517-39608539 GAGGGTGAGAAGGAGAGGCTGGG + Intronic
1183947720 22:41336127-41336149 GAGGGTGTTCAGGACAGGGAAGG + Intronic
1184196658 22:42934416-42934438 GAGGATGTGCAGCTGAGGCAGGG - Intronic
1184706174 22:46215011-46215033 GAGGGTGTGACCCAGAGGCAGGG + Intronic
1184741256 22:46430207-46430229 GAGGGTGGGCAGCAGCGGCATGG + Intronic
1184755890 22:46515542-46515564 GTGGGTGTGCACAAGCTGCAGGG + Intronic
1185329949 22:50248001-50248023 GAGGGTGCGGGGCAGAGGCACGG + Exonic
1185403257 22:50629473-50629495 GAGGGAGAGCAGAGGAGGCCTGG - Intergenic
1185404524 22:50640077-50640099 GAGGGAGAGCAGAGGAGGCCTGG - Intergenic
949533470 3:4978746-4978768 GAGGGTGAGCAGTGGGGGCAGGG + Intergenic
950405471 3:12801643-12801665 TAGGGTGGGCACCAGAGGCAAGG - Intronic
950527093 3:13530638-13530660 GTGGGTGGGCAGAAGAGTCAAGG - Intergenic
950548688 3:13653849-13653871 GAGGGTGTGGAGAAGAGAGGAGG - Intergenic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951365517 3:21777333-21777355 GAGGATGTGGAGTAGAGGAAAGG - Intronic
952272190 3:31843944-31843966 GAGAGAGGGCAGATGAGGCAAGG + Intronic
952729235 3:36621354-36621376 GATGGTGTGCAAAGGACGCATGG - Intergenic
952902258 3:38118046-38118068 GAGGGTGTGCCATCGAGGCAAGG - Intronic
953111222 3:39941088-39941110 GAGGGAGTGTACAAGAGGAAGGG + Intronic
953542524 3:43834747-43834769 CATGAGGTGCAGAAGAGGCAAGG - Intergenic
953870127 3:46619112-46619134 ATGGGAGTGCAGAAGAGGGAGGG - Intronic
953927198 3:46988509-46988531 GAGGGTGTGGAGAAGGGGAGTGG - Intronic
953929431 3:46998643-46998665 GAGGGTGGGCAGGTGAGTCAGGG - Intronic
954123151 3:48512308-48512330 AAGGAGGTGCAGAAGAGGCTAGG - Intergenic
954610941 3:51944225-51944247 GAGTATGTGCAGAGCAGGCAGGG - Intronic
955543725 3:60005113-60005135 GAGGGTGAGAAGAAAATGCAGGG - Intronic
955833227 3:63026600-63026622 GAGGGTCTGCTGCAGGGGCATGG - Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
958758712 3:98281174-98281196 GAGGCTGTGGAGAAAAGGAAAGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
961362372 3:126376037-126376059 CTGGCTGAGCAGAAGAGGCAGGG + Intergenic
961466509 3:127085044-127085066 AATCCTGTGCAGAAGAGGCACGG + Intergenic
962824856 3:139091459-139091481 GAGGGTGTTGGGAAGAAGCAAGG - Intronic
963717526 3:148821080-148821102 GAGGGGAAGAAGAAGAGGCAAGG + Intronic
964290679 3:155176955-155176977 GAGGATGGGCAGAATGGGCATGG + Intronic
965288076 3:166843077-166843099 GAGGGTGGGCAGCTCAGGCATGG - Intergenic
965340723 3:167487885-167487907 AAGGCTGTGCAGAAAAGGGAAGG + Intronic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965541090 3:169871788-169871810 GAGGATGTGAAGGAGAGGAAAGG + Intergenic
966200671 3:177357579-177357601 AAGGGTGTTCAGATAAGGCAGGG + Intergenic
966347765 3:178997923-178997945 CAGGATGTGCAGCAGAAGCATGG - Intergenic
969249919 4:5960522-5960544 GAGGCTGGACAGCAGAGGCAGGG + Intronic
969378014 4:6775915-6775937 GAGGGTGTGCAGCAGAGGCTTGG + Intergenic
969525317 4:7701252-7701274 GAGGGAGGGAAGAAGAGGGAGGG + Intronic
969950894 4:10834274-10834296 GAGGGTGGGCTGAAGAGGTGGGG + Intergenic
970169410 4:13274856-13274878 TAGAGTGTGAGGAAGAGGCAAGG - Intergenic
970434744 4:16022462-16022484 GAGGACGTGCAGAACAGGCCAGG - Intronic
970998950 4:22301023-22301045 GTGGAGGTGGAGAAGAGGCAAGG - Intergenic
972871263 4:43301843-43301865 GTGGGTGTGGAGAAAAGGGAAGG - Intergenic
974000739 4:56508281-56508303 AAGGGAATGGAGAAGAGGCAGGG + Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975510936 4:75193473-75193495 GGGGGTGTGTTGAACAGGCAAGG + Intergenic
976389960 4:84497501-84497523 GGGAGTGGGCAGAACAGGCACGG + Intronic
979377123 4:119960306-119960328 GAGGGTGAGTGGAAGAGGGATGG + Intergenic
979560686 4:122098199-122098221 GAGGCTATGTAGAAGAAGCAGGG + Intergenic
980106887 4:128596338-128596360 CAGGGTGTGCAGCAGAGCCGAGG - Intergenic
981136879 4:141220770-141220792 GAGGATCTGCAGAAAAGGAAGGG - Intergenic
983208274 4:164933189-164933211 GGGGGTGTCCTGCAGAGGCAGGG + Intergenic
984356700 4:178669303-178669325 GAGGGTGGGCAGGAGAGGTGTGG - Intergenic
984601738 4:181735698-181735720 GTGGGTTTGCAGAACAGGAATGG - Intergenic
984924527 4:184794925-184794947 GAGGATTTGCTGAAGAGGGACGG + Intronic
985202738 4:187501434-187501456 GAGGGGATGGAGAAGAGGGACGG - Intergenic
985652222 5:1112409-1112431 AAGGGCGTGCAGGAGGGGCAGGG - Intergenic
985652269 5:1112528-1112550 GAGGGGGTGCAGAAAGGGCAGGG - Intergenic
985729357 5:1538599-1538621 GAGGGTGTGCAGAGAAGAGAGGG - Intergenic
985729472 5:1539272-1539294 GAGGGTGAGAGGCAGAGGCAGGG - Intergenic
985872708 5:2570015-2570037 AAGGGTCTGCAGAAGAGGAGGGG - Intergenic
986208357 5:5647290-5647312 GAGGGGAGGAAGAAGAGGCATGG - Intergenic
986268213 5:6208780-6208802 GAGGATGTGCAGAGGGGACATGG + Intergenic
986477413 5:8149542-8149564 GAGGTTGTAAAGAAGAGGGAAGG + Intergenic
986658096 5:10034994-10035016 GAGGGTGCGGAGAGGATGCATGG - Intergenic
987086498 5:14474421-14474443 GTGGGTGTGCAGATGAAGAATGG - Intronic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
989323624 5:40165287-40165309 GAGGCTGTGCAGGAGTGGCCAGG - Intergenic
990389916 5:55308126-55308148 CAGGGTCTGCAGACAAGGCAGGG + Exonic
991262204 5:64679241-64679263 CAGGATGTGTCGAAGAGGCATGG - Intergenic
992738002 5:79743043-79743065 GGGGCTGTGGAGAAGAGGTAAGG + Intronic
994553029 5:101261125-101261147 GAGGGTGAGAAGTAGATGCAAGG - Intergenic
995134967 5:108671193-108671215 GAGGGTGAGCAGAAGAAGTGTGG - Intergenic
996150909 5:120033615-120033637 GAGTGTGAACAGAAAAGGCAAGG - Intergenic
996623879 5:125545224-125545246 GAGGGTCTTCAGAAGAGAAAAGG + Intergenic
997198373 5:131994647-131994669 TGGGGTGTGGAGAAGAGGGAAGG + Intronic
998175135 5:139897066-139897088 GAGGCAGGGCAGAATAGGCATGG - Intronic
998189209 5:140008174-140008196 GAGTCTATGCAGAAGATGCATGG + Intronic
998313582 5:141158133-141158155 GCGGCTGTGCAGAAGGAGCAGGG + Intergenic
998478537 5:142441988-142442010 AAGGATGTGGAGAGGAGGCAGGG + Intergenic
999257346 5:150216908-150216930 CAGGGTGAGCAGAACAGGCTTGG - Intronic
999295884 5:150459125-150459147 GAGGGTGGGCGGAAGGCGCAGGG + Intergenic
999453971 5:151699398-151699420 GAGGGTGTGGGGACGTGGCAGGG - Intergenic
1000280131 5:159774850-159774872 GAGTTTCTGCAGAAGAGGAAAGG + Intergenic
1000335161 5:160236616-160236638 GGGCCTGGGCAGAAGAGGCAGGG - Intronic
1000757990 5:165184559-165184581 GAGGGTGGCCAGAAGAGTGAGGG - Intergenic
1001017406 5:168153880-168153902 GAGGATGTTCAGCAGGGGCATGG + Intronic
1001093771 5:168760749-168760771 GAGGGAGTGGAGCAGAGGCTGGG + Intronic
1002296427 5:178233578-178233600 GAGGGAGTGAAGCAGAGGCCTGG - Intergenic
1002723539 5:181280646-181280668 AAGAGCGTGCAGAAGAGGGAGGG - Intergenic
1002793503 6:452031-452053 GGGGGTGTGCGGACGAGGCCAGG + Intergenic
1002860430 6:1075011-1075033 GAGGGTTTGCAGAAGAGGCCTGG - Intergenic
1004364613 6:15001116-15001138 GAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1004868715 6:19881030-19881052 AAGGGTTTGCAGGATAGGCAAGG + Intergenic
1005666430 6:28062291-28062313 TAGGGTGTCCAGAGGAGGGAGGG + Intergenic
1006199875 6:32279056-32279078 GAGGGTGAGCAGAAGTGGGGTGG + Intergenic
1006436763 6:34029757-34029779 GAAGGTGAGGAGAAGAGACATGG + Intronic
1006863042 6:37186358-37186380 GAGGATGTGGAGAAAAGGGAAGG - Intergenic
1007385410 6:41517156-41517178 GTGGGAGAGCAGAGGAGGCAGGG + Intergenic
1007633341 6:43284531-43284553 GAGGGGGTGCCGGAGAGGCCAGG + Intronic
1007783783 6:44268932-44268954 GCGGCTGTCCAGAAGAGGCGGGG - Intergenic
1008924653 6:56879106-56879128 GAAGGTGGGAAGAAGAGCCAGGG - Intronic
1009860383 6:69322481-69322503 GAGGTTGTGCAGAAAAAGGAAGG - Intronic
1011389677 6:86838195-86838217 TTTGGGGTGCAGAAGAGGCAGGG + Intergenic
1011615188 6:89191727-89191749 AAGAGTGAGCAGAAGAGCCACGG - Intronic
1012984193 6:105857491-105857513 GAGGGTGTTCAAGAGATGCATGG - Intergenic
1013615855 6:111842441-111842463 GAGAGAGTGAAGAAGAGGAAGGG - Intronic
1014266606 6:119285093-119285115 GAGGGGGAGCAGGAGAGACAGGG + Intronic
1014609947 6:123530033-123530055 GAGGCTGTGCAGGAGAGCCGTGG + Intronic
1015181702 6:130367311-130367333 GAAGGTATTCAGAAGAGACAAGG - Intronic
1015192368 6:130485439-130485461 GATGGTAAGCAGAAGAGGCAGGG + Intergenic
1016260488 6:142163689-142163711 GGGGGTGTGGGGAAGAGGCATGG + Intronic
1017279602 6:152609139-152609161 GAGGGTGAGCTGACGAAGCAGGG + Intronic
1017629394 6:156381669-156381691 GAAAGTGGGGAGAAGAGGCAAGG - Intergenic
1018885920 6:167937106-167937128 GAGTGTGTACAGAAGGTGCAGGG + Intronic
1019468418 7:1203522-1203544 GAGGTTGTGCAGCAGAGGCCGGG + Intergenic
1019556185 7:1632726-1632748 GGGGGGAGGCAGAAGAGGCAAGG - Intergenic
1019657363 7:2203043-2203065 GAGGGGCTGCAGAGGAGGCTGGG - Intronic
1021210422 7:17845105-17845127 GAGGGAGGGGAGAAGAGGTAAGG + Intronic
1021451605 7:20787239-20787261 GAGAGAGTGCAGAAAAGGGAGGG + Intergenic
1021539011 7:21736362-21736384 TAGGGTGAGCAAAAGAGACATGG + Intronic
1022038013 7:26552253-26552275 GAGGGAGTGCAGAGGAGGGATGG + Intergenic
1023829601 7:44031068-44031090 GAGGGTGGGGAGCCGAGGCAGGG - Intergenic
1024695995 7:51857257-51857279 GAGGGTGTTGGGCAGAGGCAGGG + Intergenic
1026392088 7:69912082-69912104 GAGGGGGTGCTGAGGTGGCAGGG + Intronic
1026892477 7:73990374-73990396 GAGGGGGTAGAGAGGAGGCAGGG - Intergenic
1027730101 7:81860570-81860592 GAGGATGTGGAGAATAGGGACGG + Intergenic
1028998447 7:97127095-97127117 GAGGGCGAGCAGAAGCAGCATGG - Intronic
1029459349 7:100686330-100686352 GAGGGTGTGGTGAAGAGGAGGGG - Exonic
1029679192 7:102096276-102096298 AAGGGTGTTCAGAAGAGTCAGGG - Intronic
1029739909 7:102485326-102485348 GAGGGTGGGGAGCCGAGGCAGGG - Intronic
1029757908 7:102584505-102584527 GAGGGTGGGGAGCCGAGGCAGGG - Intronic
1029775844 7:102683566-102683588 GAGGGTGGGGAGCCGAGGCAGGG - Intergenic
1031401382 7:121329242-121329264 GAGGGGGTGCAAAAGAGGAGCGG + Exonic
1031598160 7:123671486-123671508 GAGAGTGTGGAGAAGAGCAAAGG - Intergenic
1032462192 7:132120258-132120280 GAGGGTATGCACTAGAGCCAAGG - Intergenic
1032504978 7:132427924-132427946 GAACGTGTGCATAACAGGCAAGG + Intronic
1032679932 7:134171867-134171889 TAGGTTGTGCAGGAGAGGGAGGG + Intronic
1033124831 7:138698397-138698419 GGGGGTGTGAGGAAGAGACAAGG - Intronic
1033131563 7:138749792-138749814 GAGGCTCTGCTGAAGGGGCAGGG - Intronic
1034487469 7:151374894-151374916 GAGGGGGTGCACAGGAGGCAGGG + Intronic
1035085044 7:156251096-156251118 GTGTGTGTGCAGACAAGGCAGGG + Intergenic
1035092870 7:156329183-156329205 GAGGGTGTGGAGAAGGGTCTGGG - Intergenic
1037617627 8:20533898-20533920 GAGGGAGTGAAGAAGAGCCATGG + Intergenic
1037627023 8:20617241-20617263 TAGAGTGTAAAGAAGAGGCATGG - Intergenic
1037654688 8:20872816-20872838 GTGGGGTTGCAGCAGAGGCAGGG + Intergenic
1037753741 8:21698536-21698558 CAGGGAGTGCAGGAGAGCCATGG - Intronic
1039789975 8:40867748-40867770 AAAGGTTTGCAGAAGAGGAATGG - Intronic
1041233395 8:55775297-55775319 TAGGGTGTGCACAGTAGGCAGGG + Intronic
1041412812 8:57575269-57575291 GAGGCTGGACAGAAGAGGAAAGG + Intergenic
1042842856 8:73141581-73141603 GAGTATGTGTAGGAGAGGCAGGG - Intergenic
1042992538 8:74656720-74656742 GAGGGTATCCTGGAGAGGCAAGG + Intronic
1043209111 8:77488489-77488511 GAGGAAGAGCAGCAGAGGCAGGG + Intergenic
1043414673 8:80034393-80034415 CAGGCTCTGCAGAAGTGGCAGGG - Intronic
1043474118 8:80589839-80589861 CAGGGTGTGCACAAGAGGGGAGG + Intergenic
1043654054 8:82639685-82639707 AAGGATGTGAAGTAGAGGCAGGG + Intergenic
1044647986 8:94464890-94464912 GAGGGAGAGCAAAAGAGGGAGGG + Intronic
1044755593 8:95458069-95458091 GTGGATGTGGAGAAGAGGAATGG + Intergenic
1045121594 8:99043528-99043550 GAGTGTGTGTAGAAGAGTAATGG - Intronic
1046277725 8:111985433-111985455 GAGGGTGAGCCAAAGAAGCACGG + Intergenic
1046688535 8:117255732-117255754 AAGGCTGTGCAGAAAAGGGAGGG + Intergenic
1048338247 8:133519044-133519066 AAGGGTAAGCAGAAGAGACATGG + Intronic
1048365125 8:133731790-133731812 GAGGGTGTGCAGAGGAGGAAAGG + Intergenic
1048592379 8:135832846-135832868 GAGGATGTACAGAAGTGGCCAGG - Intergenic
1049200159 8:141336197-141336219 GAGGGTCTGCAGGGGAGGCCGGG - Intergenic
1049278295 8:141730974-141730996 GAGGGTGTGCAGGGGAGGCTGGG + Intergenic
1049296328 8:141841836-141841858 GAGAGTGTGGAGAACAGGGAAGG - Intergenic
1049544549 8:143223845-143223867 GAGGGTTTGCAGAAAAGGCTGGG - Intergenic
1049879894 8:145054649-145054671 GAGGAAGTACAGAAGATGCAGGG + Exonic
1051787616 9:20762810-20762832 GAGGGTGGGAAGGAGGGGCAAGG - Intronic
1052944156 9:34154176-34154198 TAGAGTGTGCAGAAGAGGAAAGG - Intergenic
1056776627 9:89517780-89517802 GAGGTTGTGGAGAAAAGGAAAGG - Intergenic
1057266894 9:93623079-93623101 GAGGGTGTGGACATGGGGCATGG + Intronic
1057295190 9:93830535-93830557 AAGGGGGTGCAGAGGAGGAAGGG - Intergenic
1057413095 9:94835771-94835793 GAGGGAGTGCAGTAGGGCCAAGG + Intronic
1057420167 9:94905869-94905891 CAGGGAGTGCAGAAGGGGCTGGG + Intronic
1057517599 9:95735228-95735250 AAGTGTTTGCAGGAGAGGCAGGG - Intergenic
1057913714 9:99039885-99039907 GGGGATCTGCAGGAGAGGCAGGG - Intronic
1058182436 9:101815365-101815387 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1058311487 9:103509208-103509230 GAGACTCTGCAAAAGAGGCAAGG + Intergenic
1059482934 9:114606139-114606161 GCGGCTGTGGAGAAGAGGCAAGG - Intergenic
1060074503 9:120579667-120579689 GAGCGTGTGAAGAACAGGTAAGG - Intronic
1060264183 9:122100880-122100902 ATGGGTGTGCAGAAGTGGAAAGG - Intergenic
1060269703 9:122131897-122131919 GAGGCTGGGGGGAAGAGGCATGG + Intergenic
1060295046 9:122337650-122337672 GAGGGTGTGCTCAAGATGCTTGG + Intergenic
1060552974 9:124494417-124494439 GAGGATCTGTAGAGGAGGCAAGG - Intronic
1060817437 9:126642561-126642583 GGGGGTGCCCAGAGGAGGCAGGG - Intronic
1060987827 9:127829928-127829950 GAGGGTGGACAGAGCAGGCAGGG - Intronic
1061083467 9:128385877-128385899 GGGGGCGGGCAGAAGAGGGAGGG + Intronic
1061200654 9:129136657-129136679 GAGGGAGCGCAGGAGGGGCAGGG - Intronic
1061375094 9:130219537-130219559 GAGGGTGGGGAGCAGAGGCTGGG - Intronic
1061481270 9:130898782-130898804 GTGGGTGGGTAGAAGAGGGAGGG - Intergenic
1061572160 9:131484597-131484619 GAGTGTGTTCAGGAGAGCCATGG + Intronic
1062014222 9:134283169-134283191 GAGGGTTGGCAGCAGAGGCGGGG - Intergenic
1062444833 9:136589238-136589260 CAGTGTGAGCGGAAGAGGCAGGG + Intergenic
1062487677 9:136788320-136788342 TAGATTGTGAAGAAGAGGCAGGG - Intergenic
1185468600 X:369675-369697 GAGGGTGCGCACAGCAGGCAGGG + Intronic
1185776794 X:2809681-2809703 GAGGGAGTTCAGAAGAGACCAGG - Intronic
1186410491 X:9341665-9341687 GAGGGGGTGCCGTTGAGGCAGGG - Intergenic
1188899867 X:35717596-35717618 GAGGATGTGGAGAAAAGGAAAGG - Intergenic
1189644753 X:43115976-43115998 AAGGAAGTGCAGAAGTGGCAAGG - Intergenic
1190747414 X:53332691-53332713 GAGGGAGGACAGAAGACGCAGGG - Intergenic
1191717299 X:64202566-64202588 GAAGGTGTTCAGCAGAGGCCTGG + Intronic
1192202933 X:69078403-69078425 GAGGGAGGGCACAGGAGGCAGGG - Intergenic
1192394678 X:70767472-70767494 GAGGGTGTGGAGAAAAGGGGTGG + Intronic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193399177 X:81021668-81021690 GATGATGTGCAGCAAAGGCAAGG + Intergenic
1193935980 X:87622349-87622371 CATGATGTGCAGAATAGGCAAGG + Exonic
1194078620 X:89429946-89429968 GAGGTTGTGGAGAAAAGGGAAGG - Intergenic
1194276183 X:91885591-91885613 CAGTGTGTGCAGAAAAGGAAAGG - Intronic
1195210703 X:102651015-102651037 GAGGGTGAGCAGACTAGGGAGGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197226462 X:123960732-123960754 GAGGGTGTAAAGAAGAGGAAGGG + Exonic
1197472861 X:126883879-126883901 GAGTGTGTGCACCAGAGACATGG - Intergenic
1197562982 X:128047347-128047369 CTTGGTGGGCAGAAGAGGCAGGG + Intergenic
1197598684 X:128499846-128499868 GAGGTTGTGAAGAAAAGGGAAGG - Intergenic
1198199258 X:134398972-134398994 GAGAGCGTTCAGAAGAGGAAAGG + Intronic
1198524862 X:137490981-137491003 GGGGGGATACAGAAGAGGCAAGG - Intergenic
1198612373 X:138416467-138416489 GAGGTTGTGGAGAAAAGGGAAGG - Intergenic
1199342847 X:146702367-146702389 GAGGGTGTACGGAGGGGGCAAGG - Intergenic
1200431228 Y:3085068-3085090 GAGGTTGTGGAGAAAAGGGAAGG - Intergenic
1200593431 Y:5107045-5107067 CAGTGTGTGCAGAAAAGGAAAGG - Intronic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic