ID: 1062779786

View in Genome Browser
Species Human (GRCh38)
Location 10:191988-192010
Sequence AACCCCATGCTGTTGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062779786_1062779788 27 Left 1062779786 10:191988-192010 CCTCAAAACAACAGCATGGGGTT No data
Right 1062779788 10:192038-192060 TGCAAATCGAGATGCAGTGAGGG No data
1062779786_1062779787 26 Left 1062779786 10:191988-192010 CCTCAAAACAACAGCATGGGGTT No data
Right 1062779787 10:192037-192059 ATGCAAATCGAGATGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062779786 Original CRISPR AACCCCATGCTGTTGTTTTG AGG (reversed) Intronic
No off target data available for this crispr