ID: 1062781956

View in Genome Browser
Species Human (GRCh38)
Location 10:220275-220297
Sequence ATGTAGTAACCAAATGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 848
Summary {0: 1, 1: 0, 2: 2, 3: 71, 4: 774}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062781956 Original CRISPR ATGTAGTAACCAAATGAACA AGG (reversed) Intronic
901389878 1:8937949-8937971 ATAGAGGAGCCAAATGAACAAGG - Intergenic
906588154 1:46998951-46998973 CTATAGTAACCAAATCAACATGG - Intergenic
907014426 1:50998042-50998064 ATATAGTAATCAAAACAACACGG + Intergenic
907568559 1:55460872-55460894 CTATAGTAACCAAAACAACATGG + Intergenic
907579992 1:55563205-55563227 CTATAGTAACCAAAATAACATGG - Intergenic
908180492 1:61599366-61599388 AAGTAGTAACCAAAAGAGCAGGG + Intergenic
908861103 1:68490794-68490816 CTGTAGTAACCAAAACAAAATGG + Intronic
909183546 1:72455395-72455417 ATATAGTAACCAAAACAGCATGG + Intergenic
909232430 1:73106750-73106772 CTGCAGTAACCAAAACAACATGG + Intergenic
909244757 1:73266825-73266847 TTATAGTAAGCAAATCAACATGG + Intergenic
909420146 1:75455132-75455154 TTGTAGTAACCAAAACAGCATGG + Intronic
909708509 1:78616124-78616146 CTGTAGTAACCAAAACAGCATGG + Intergenic
910374728 1:86555578-86555600 ATGCAGTAACCCAAAGAGCATGG - Intronic
911279787 1:95909945-95909967 GTGTAGTAACCAAAACAGCATGG - Intergenic
911486263 1:98510148-98510170 CTGTAGTAACCAAATCAGTATGG + Intergenic
911564624 1:99449397-99449419 CTATAGTAACCAAAACAACATGG + Intergenic
911812351 1:102298873-102298895 GTATAGTAACCAAAACAACATGG + Intergenic
912071270 1:105812917-105812939 CTGTAGTAACCAAAACAGCAAGG + Intergenic
912148738 1:106829376-106829398 CTGTAGTAATCAAAACAACATGG + Intergenic
912231745 1:107801191-107801213 ATATAGTAACCAAATCAGCATGG - Intronic
912885318 1:113465383-113465405 CTATAGTAACCAAATCAGCATGG - Intronic
912907607 1:113723077-113723099 CTATAGTAACCAAAGGAGCATGG + Intronic
913060546 1:115201770-115201792 CTATAGTAACCAAACCAACATGG + Intergenic
913472224 1:119200581-119200603 CTATAGTAACCAAAACAACATGG + Intergenic
915464150 1:156086480-156086502 ATGTACTAAACAACTCAACAGGG - Intronic
915640694 1:157222872-157222894 CTGTAGTAACCAAAACAGCATGG - Intergenic
915688466 1:157661842-157661864 CTATAGTAACCAAATCAGCATGG - Intergenic
915784353 1:158592923-158592945 ATCTAGTAACCAAAGAATCATGG + Intergenic
916245173 1:162680514-162680536 CTGTAGTAACCAAAACAGCATGG - Intronic
916301632 1:163281679-163281701 CTATAGTAACCAAAAGATCATGG + Intronic
916355656 1:163903985-163904007 CTGTAGTTACCAAATCAGCATGG - Intergenic
916392883 1:164350858-164350880 CTGTAGTAACCAAAACATCATGG + Intergenic
916637334 1:166686915-166686937 CTATAGTAACCAAAAGAGCATGG - Intergenic
916700890 1:167293718-167293740 CTGTAGTTACCAAAGCAACATGG + Intronic
916807857 1:168277251-168277273 ATATAGTAACCAAAACAGCATGG - Intergenic
917202201 1:172529674-172529696 AGGTAGTAACTAAATAAAGAAGG + Intergenic
917423625 1:174890811-174890833 ATGTAGCTTTCAAATGAACAAGG - Intronic
917524791 1:175778595-175778617 CTATAGTAACCAAAACAACATGG + Intergenic
918182803 1:182099582-182099604 ATATAGTAACCAAAACAGCATGG - Intergenic
918787668 1:188784442-188784464 AATTAGTAACCACAAGAACATGG - Intergenic
919009076 1:191936244-191936266 CTGTAGTAAACAAAACAACATGG + Intergenic
919223829 1:194667440-194667462 CTGTAGTAACCAAACCAGCATGG + Intergenic
919287971 1:195589720-195589742 CTGTAGCAACCAAAACAACATGG + Intergenic
919288963 1:195603546-195603568 CTGTAGTAACCAAAACAGCATGG - Intergenic
919316468 1:195976806-195976828 TTGTAGTAACCAAAACAACATGG - Intergenic
919358300 1:196555758-196555780 CTGTAGTAACCAAAACAGCATGG + Intronic
919627073 1:199921879-199921901 CTATAGTAACCAAAACAACATGG - Intergenic
920934746 1:210421245-210421267 CTGTAGTAACCAAAACATCATGG + Intronic
920934985 1:210423919-210423941 CTGTAGTAACCAAAACAGCATGG - Intronic
920998848 1:211022086-211022108 TTATAGTAACCAAAACAACAGGG + Intronic
921518581 1:216129818-216129840 CTATAGTAACCAAAACAACATGG + Intronic
921557847 1:216620637-216620659 TTGTGGTAACAAAATGAATAAGG + Intronic
921994418 1:221402330-221402352 CTATAGTAACCAAAGCAACATGG + Intergenic
922003889 1:221509045-221509067 CTGTAGTAACCAAAACAGCATGG + Intergenic
923204736 1:231747642-231747664 CTGTAGTAACCAAAACAACATGG - Intronic
923269587 1:232343315-232343337 TTATAGTAACCAAAACAACATGG + Intergenic
923748191 1:236722966-236722988 TTGTAGTAACCAATTGAAGAAGG + Intronic
924929845 1:248720618-248720640 CTGTAGTAACCAAAACAACATGG + Intronic
1062781956 10:220275-220297 ATGTAGTAACCAAATGAACAAGG - Intronic
1063532206 10:6844437-6844459 ATGTAGTAAAGAACTCAACAGGG - Intergenic
1064823609 10:19368498-19368520 CTGTAGTAACCAAAACAACATGG - Intronic
1065929397 10:30465893-30465915 CTGTAGTAACCAAAACAGCATGG - Intergenic
1066155104 10:32667749-32667771 CTGCAGTAACCAAAAGAGCATGG - Intronic
1066190533 10:33051448-33051470 ATATAGTAACCAAAACAGCATGG - Intergenic
1066273855 10:33849219-33849241 CTATAGTAACCAAAAGAGCATGG - Intergenic
1067252445 10:44598925-44598947 CTGTAGTAACCAAAACAGCATGG + Intergenic
1068396451 10:56467861-56467883 CTATAGTAACCAAAACAACATGG + Intergenic
1068445004 10:57109271-57109293 GTGTAGTAATCAAAACAACATGG + Intergenic
1068474761 10:57510245-57510267 ATATAGTAACCAAAACAGCATGG - Intergenic
1068838624 10:61585018-61585040 CTATAGTAACCAAAAGAGCATGG + Intergenic
1068857603 10:61813368-61813390 ATCTAGGAAACAAATAAACAGGG + Intergenic
1069188576 10:65459689-65459711 CTGTAGTAACCAAAACAGCATGG - Intergenic
1069349694 10:67510574-67510596 CTGCAGTAACCAAAAGAGCATGG - Intronic
1069850605 10:71401898-71401920 ATGTTGAATCCAAATAAACATGG - Intronic
1070894414 10:79970252-79970274 CTGTAGTAACCAAAACAGCATGG - Intronic
1071002487 10:80845863-80845885 CTGTAGTAACCAAAACAACATGG + Intergenic
1071064846 10:81619186-81619208 CTGTAGCAACCAAAACAACATGG + Intergenic
1071209678 10:83324867-83324889 TTATAGTAACCAAATCAGCATGG + Intergenic
1071216924 10:83415998-83416020 CTATAGTAACCAAATTAACCTGG - Intergenic
1071248788 10:83793730-83793752 CTATAGTAACCAAATCAGCATGG - Intergenic
1071314851 10:84385367-84385389 CTGTAGTAACCAAAACAGCATGG + Intronic
1071582119 10:86781411-86781433 CTGTAGTAACCAAAACAGCATGG - Intronic
1071875929 10:89843200-89843222 CTGTAGTAACCAAAACAGCATGG - Intergenic
1072051166 10:91704553-91704575 AACTAGTAACCAAATCAGCATGG - Intergenic
1072054062 10:91736012-91736034 CTATAGTAACCAAAAGAGCATGG - Intergenic
1072777782 10:98217395-98217417 CTGTAGTAACCAAAACAGCATGG - Intronic
1072875935 10:99173367-99173389 ACCTAGTAGCCAAATGAATATGG + Intronic
1073170197 10:101499855-101499877 TTGTAATAACTAAATGAATATGG - Intronic
1074207362 10:111295413-111295435 CTATAGTAACCAAAACAACATGG - Intergenic
1075012106 10:118882248-118882270 CTATAGTAACCAAATCAGCATGG + Intergenic
1076377081 10:129997766-129997788 CTATAGTAACCAAAACAACACGG + Intergenic
1076537791 10:131193720-131193742 ATATAGTAACCAAAACAGCATGG - Intronic
1076944364 10:133635104-133635126 CTGTAGTAACCAAAACAACATGG + Intergenic
1077721267 11:4631728-4631750 CTATAGTAACCAAAAGAGCATGG + Intergenic
1077859656 11:6165328-6165350 CTGTAGTAACCAAAACAGCATGG + Intergenic
1078692079 11:13592057-13592079 ATGTAGTAACCAAAACAGCATGG + Intergenic
1079647198 11:22880352-22880374 AGGTAGTTTCCAAATGAAAAAGG - Intergenic
1079748277 11:24160692-24160714 CTATAGTAACCAAAACAACATGG + Intergenic
1079781681 11:24614828-24614850 AAGAAGTAATCAAATTAACAAGG - Intronic
1080397214 11:31901312-31901334 AGGTACTATCCAACTGAACATGG - Intronic
1080601421 11:33823984-33824006 CTATAGTAACCAAAACAACATGG - Intergenic
1080992035 11:37548116-37548138 ATGTAGTAACCTAATTTGCAGGG + Intergenic
1081073291 11:38636646-38636668 CTTTAGTAACCAAAATAACATGG - Intergenic
1081095729 11:38932073-38932095 CTATAGTAACCAAAAGAGCATGG - Intergenic
1081407850 11:42718558-42718580 CTATAGTAACCAAATCAGCATGG + Intergenic
1082733943 11:56835438-56835460 ATATAGTAATCAAAACAACATGG - Intergenic
1082942591 11:58723686-58723708 ATTTAGCAACCAAATGGATATGG - Intronic
1083161087 11:60854491-60854513 ATGGAGTAAGTGAATGAACAGGG - Intronic
1085082339 11:73645639-73645661 ATTTAGCAACCAGATGAAAAAGG - Intergenic
1085686346 11:78625320-78625342 CTGTAGTAACCAAAACCACATGG - Intergenic
1085842274 11:80026061-80026083 CTATAGTAACCAAATCAGCATGG + Intergenic
1086015669 11:82164002-82164024 ATGTAGTAACTAAAAAAGCATGG - Intergenic
1086720497 11:90115439-90115461 CTGTAGTAACCAAAACATCATGG + Intergenic
1086874623 11:92080505-92080527 CTATAGTAACCAAATCAGCACGG + Intergenic
1086999601 11:93401555-93401577 CTATAGTAACCAAATCAACATGG + Intronic
1087154680 11:94889388-94889410 GTATAGTAACCAAAACAACATGG - Intergenic
1087497791 11:98911811-98911833 ATATAGTAACCAAAACAGCAAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087675863 11:101160505-101160527 CTGTAGTAACCAAATCAGCATGG - Intergenic
1087970964 11:104483292-104483314 ATATAGTAACCAAAATAGCATGG + Intergenic
1088406361 11:109483979-109484001 ATATAGTAACCAAAATAGCATGG + Intergenic
1088571206 11:111225210-111225232 CTGTAGTAACCAAAACAGCATGG + Intergenic
1091574349 12:1719463-1719485 ATTTAGTAACTATATGAACATGG + Intronic
1092311798 12:7365035-7365057 TTATAGTAACCAAATCAGCATGG + Intronic
1092636825 12:10460317-10460339 CTATAGTAACCAAAACAACATGG - Intergenic
1092803473 12:12196070-12196092 TTGTAGTAACCAAAACAGCATGG - Intronic
1093119477 12:15251244-15251266 CTATAGTAACCAAAACAACATGG + Intronic
1093748000 12:22764904-22764926 ATTTAGGAAACAAATGAACAGGG + Intergenic
1093835210 12:23820803-23820825 CTGTAGTAACCAAAACACCACGG - Intronic
1093907993 12:24714481-24714503 CTGGAGTAAGGAAATGAACAAGG - Intergenic
1093952550 12:25180549-25180571 CTGTAGCAACCAAAATAACATGG + Intronic
1095086375 12:38060991-38061013 CTGCAGTAACCAAAAGAGCATGG - Intergenic
1095181225 12:39148615-39148637 ATATAGTAACCAAAACACCATGG - Intergenic
1095303349 12:40613207-40613229 ATTTAGTAACCCAATGCAAAGGG - Intergenic
1095744999 12:45648225-45648247 ATGGAGTAACCGAAAGCACAAGG + Intergenic
1096051518 12:48613643-48613665 ATGAAGCAACCACATAAACAAGG - Intergenic
1096930469 12:55202943-55202965 CTATAGTAACCAAAAGAGCATGG + Intergenic
1097393337 12:59042275-59042297 ATGCAGTGAGCAAATGAAGATGG - Intergenic
1097581165 12:61458672-61458694 GTGTAGTAACCAAAACAGCATGG - Intergenic
1099093851 12:78347745-78347767 CTATAGTAACCAAATCAGCATGG + Intergenic
1099673261 12:85722297-85722319 GTGTAGTAAACAAATGAGGATGG - Intergenic
1099768789 12:87025461-87025483 CTGTAGTAACCAAAACAGCATGG + Intergenic
1100173127 12:91999932-91999954 CTGTAGTAACTAAAACAACATGG + Intronic
1100582915 12:95952434-95952456 CTATAGTAACCAAAAGAGCATGG - Intronic
1101083413 12:101211053-101211075 AAGTTGTATACAAATGAACAAGG - Intergenic
1101832884 12:108273033-108273055 GTGTAGAAACCAAATGCCCATGG + Intergenic
1102655079 12:114475800-114475822 CTATAGTAACCAAATCAGCATGG - Intergenic
1103758532 12:123231327-123231349 ATTTATTAAACAAATGAACAAGG - Intronic
1104056894 12:125237395-125237417 ATCTAGGAAGGAAATGAACAGGG - Intronic
1105273734 13:18902507-18902529 ATCTAGTAACCAAAACAGCATGG + Intergenic
1105313170 13:19231269-19231291 ATGTAATAAACAAGTGAACCAGG + Intergenic
1105478586 13:20751538-20751560 CTGTAGTAACCAAAACAGCATGG - Intronic
1105875565 13:24549802-24549824 CTGTAGTAACCAAAACAGCATGG - Intergenic
1105981603 13:25521852-25521874 CTGTAGTAACCAAATCAGCATGG - Intronic
1106366538 13:29086503-29086525 ATATAGTAACCAAAACATCATGG - Intronic
1106812922 13:33377902-33377924 ATCTAAAAACCAAATGAACAAGG + Intergenic
1106829403 13:33563339-33563361 CTATAGTAACCAAATCAGCATGG + Intergenic
1106860344 13:33900289-33900311 CTATAGTAACCAAATCAGCATGG + Intronic
1108543694 13:51469431-51469453 ATGGAGTCACTAAAAGAACATGG - Intergenic
1108902427 13:55428395-55428417 TTATAGTAACCAAAATAACATGG + Intergenic
1109003516 13:56836896-56836918 CTATAGTAACCAAAATAACATGG + Intergenic
1109254127 13:60057656-60057678 ATATAGTAACCAAAACAGCATGG + Intronic
1109442250 13:62390623-62390645 ATGCAATTATCAAATGAACAAGG - Intergenic
1109568198 13:64147923-64147945 ATGTTGTAACCGAAAGAAGAAGG + Intergenic
1109615836 13:64832779-64832801 CTGCAGTAACAAAATCAACATGG + Intergenic
1109824778 13:67704267-67704289 CTATAGTAACCAAAAGAGCATGG + Intergenic
1110088511 13:71413362-71413384 ATGTAGTAATCAAAACAACGTGG - Intergenic
1110388874 13:74948337-74948359 CTGTAGTAACCAAAAAAGCATGG + Intergenic
1110625965 13:77656168-77656190 CTATAATAACCAAATCAACATGG - Intergenic
1110901130 13:80826072-80826094 CTGTAGTAACCAAAACAGCATGG - Intergenic
1111056731 13:82960075-82960097 ATGTTGTAATCAATTAAACAAGG + Intergenic
1111140290 13:84108910-84108932 ATATAGTAACCAAAAAAGCATGG - Intergenic
1111463829 13:88581314-88581336 GTAAAGAAACCAAATGAACAAGG + Intergenic
1111490926 13:88974103-88974125 GTATAGTAACCAAAAGAGCAGGG + Intergenic
1111763542 13:92497484-92497506 CTGCAGTAACCAAAACAACATGG - Intronic
1111796691 13:92929468-92929490 CTATAGTAACCAAAACAACATGG + Intergenic
1112088972 13:96062272-96062294 CTGTAGAAACCAAATCAGCATGG + Intergenic
1112362186 13:98728232-98728254 CTGTAGTAACCAAATCAGCATGG - Intronic
1112577656 13:100650714-100650736 ATGAAGCAACCAAAGAAACAGGG + Intronic
1113257848 13:108526789-108526811 ATGTAGTGACCAACAGAAAAAGG - Intergenic
1113528126 13:110998310-110998332 CTGCAGTAACCAAAAGAGCATGG + Intergenic
1114127060 14:19740877-19740899 CTATGGTAACCAAAAGAACATGG + Intronic
1114691205 14:24583732-24583754 CTATAGTAACCAAATCAGCATGG - Intergenic
1114832284 14:26159498-26159520 ATATAGTAATCAAAAGAACATGG - Intergenic
1114932831 14:27495191-27495213 CTGTAGTAACCAAAACAGCATGG + Intergenic
1115033966 14:28834876-28834898 ATGTAGAAAACATATGATCAGGG - Intergenic
1115270706 14:31549172-31549194 CTATAGTAACCAAAACAACATGG - Intronic
1115443104 14:33458756-33458778 ATTAAGTAACCAAAAGAAAAAGG + Intronic
1115714765 14:36091114-36091136 ATGGAGTAAACAAATGAAGAGGG - Intergenic
1115973961 14:38976569-38976591 CTGCAGTAACCAAAACAACATGG - Intergenic
1116102342 14:40456158-40456180 CTGTAGTAACCAAAACAACATGG - Intergenic
1116106757 14:40517897-40517919 ATATAGTAACCAAAACAACCTGG + Intergenic
1116276127 14:42834352-42834374 ATGTAGTAACTAACTGATCCTGG - Intergenic
1116424212 14:44769692-44769714 ACCTAATAACCAAATGAACTTGG - Intergenic
1116434658 14:44883454-44883476 CTATAGTAACCAAAACAACACGG + Intergenic
1116475710 14:45336252-45336274 CTGTAGTAACCAAAAAATCATGG - Intergenic
1116574436 14:46554867-46554889 CTGCAGTAACCAAAACAACATGG - Intergenic
1116734802 14:48675556-48675578 ATGCAGTAACCAAAACAGCATGG + Intergenic
1116825461 14:49669240-49669262 GTGTAGTATCCAAATGAGCTAGG + Intronic
1117633559 14:57719216-57719238 ATATAGTAACCAAAACAGCATGG - Intronic
1118020551 14:61708684-61708706 ATGCAGTAACCAAAACAGCATGG - Intronic
1118546951 14:66901753-66901775 CTATAGTAACCAAATCAACATGG - Intronic
1118671083 14:68128124-68128146 ATGTAGAAACCTTCTGAACATGG + Intronic
1118754683 14:68831909-68831931 TTGTAATAACCAAATCAGCATGG - Intergenic
1119026971 14:71161001-71161023 CTGTAGTAACCAAAACAGCATGG + Intergenic
1119152860 14:72379928-72379950 CTGTAGTAACCAAAACAGCATGG + Intronic
1120392589 14:83927707-83927729 TTGTAGTAACCAAAACAATATGG + Intergenic
1120723418 14:87912004-87912026 CTGCAGTAACCAAAATAACATGG - Intronic
1120771814 14:88387411-88387433 ATGTAATCACCAAATAACCAGGG + Intronic
1202917764 14_KI270723v1_random:449-471 CTGTAGTAACCAAAACAGCATGG + Intergenic
1202926861 14_KI270724v1_random:34136-34158 CTGTAGTAACCAAAACAGCATGG - Intergenic
1202934637 14_KI270725v1_random:75462-75484 CTGTAGTAACCAAAACATCATGG + Intergenic
1124191206 15:27578715-27578737 TTATAGTAACCAAAAGAGCACGG + Intergenic
1124554755 15:30714333-30714355 CTATAGTAACCAAAAGAGCATGG - Intronic
1124676491 15:31691347-31691369 CTATAGTAACCAAAAGAGCATGG + Intronic
1124713316 15:32032539-32032561 ATGCAGAAACCACATGAAAAAGG + Intronic
1125052204 15:35312900-35312922 CTGTAGTAACCAAATCTACATGG - Intronic
1125867487 15:43066347-43066369 CTGTAGTAACCAAAACAGCATGG - Intronic
1126216615 15:46162716-46162738 CTGTAGTAACCAAAACAGCATGG + Intergenic
1126372059 15:47957875-47957897 CTATAGTAACCAAAAGAGCATGG - Intergenic
1126482994 15:49147779-49147801 ATGTAGTCACAAAACGAAGAGGG - Intronic
1126654521 15:50962369-50962391 CTGTAGTAACCAAAACAACATGG + Intronic
1126971538 15:54118027-54118049 CTATAGTAACCAAATCAGCATGG - Intronic
1127027520 15:54823835-54823857 CTATAGTAACCAAAGCAACATGG - Intergenic
1127035576 15:54913401-54913423 ATATAGTAACCAAAACAGCATGG + Intergenic
1127057570 15:55147915-55147937 CTGTAGTAACCAAAACAGCATGG + Intergenic
1127155465 15:56119890-56119912 CTGTAGTAACCAAAACAGCATGG - Intronic
1127156020 15:56125232-56125254 CTGTAGTAACCAAAACAGCATGG - Intronic
1127491143 15:59465193-59465215 CTGTAGTAACCAAAACAGCATGG - Intronic
1129500303 15:76030344-76030366 CTGTAGTAACCAAAACAGCATGG + Intronic
1129922406 15:79330793-79330815 CTGTAGTAACCAAAACAGCATGG + Intronic
1130186107 15:81684439-81684461 ATGTAGTGATCAAATAAATATGG + Intergenic
1130419212 15:83725773-83725795 CTGTAGTAACCAAAACATCATGG - Intronic
1130713532 15:86308801-86308823 CTGTAGTAACCAACTCCACATGG - Intronic
1132037315 15:98495925-98495947 GTGTAGTAACCCAAACAACATGG - Intronic
1132139301 15:99377923-99377945 ATATAGTAACCAAAACAGCATGG - Intronic
1133568783 16:7021245-7021267 AAGTAGTAACCAAATGAGGTGGG - Intronic
1135069351 16:19338582-19338604 ATTTAGTATCCAAGGGAACAAGG + Intergenic
1137794316 16:51202453-51202475 ATGTAGTGAGCCAATGAAAAGGG - Intergenic
1138308267 16:55999073-55999095 TTGTAGTAACCAAAACAGCATGG - Intergenic
1138980974 16:62267861-62267883 CTATAGTAACCAAATGCAAATGG + Intergenic
1139262529 16:65608646-65608668 ATGTAGTACCAAGATGAATAAGG + Intergenic
1139663485 16:68438659-68438681 AAGTTGTGATCAAATGAACAGGG - Intronic
1140077305 16:71712658-71712680 ATGTAGTAAACTGGTGAACAAGG + Intronic
1140157686 16:72449922-72449944 CTGTAGTAACAAAAACAACATGG - Intergenic
1140672180 16:77290300-77290322 ATATATTAAGCAAATGAACATGG + Intronic
1141350857 16:83294653-83294675 ATTTAGGAACAAATTGAACAAGG + Intronic
1142375457 16:89704678-89704700 AGGTGGTAACCCAATGACCAGGG - Intergenic
1144812649 17:18010578-18010600 TTGTAGTAACCAAAACAGCATGG + Intronic
1145132842 17:20373541-20373563 TTACAGTAACCAAAAGAACAAGG - Intergenic
1146707968 17:35015657-35015679 CTGTAGGAACCAAATCAACTGGG + Intronic
1147519399 17:41155108-41155130 CTATAGTAACCAAAACAACATGG - Intergenic
1148429453 17:47630502-47630524 GTGTAGTCACCAAGTTAACAGGG - Intergenic
1149246119 17:54710527-54710549 CTGCAGTAACCAAAACAACATGG + Intergenic
1149615821 17:57997501-57997523 ATGTATTTACCAAATCAACCAGG + Intronic
1149624678 17:58072439-58072461 AAATACTAACAAAATGAACATGG + Intergenic
1150180079 17:63110036-63110058 CTCTAGTAACCATATGAAAATGG + Intronic
1150513460 17:65781614-65781636 CTGTAGTAACCAAAACAGCATGG + Intronic
1152528075 17:80900938-80900960 ATGTGGTATCCAAATGCCCAGGG - Intronic
1203191658 17_KI270729v1_random:195978-196000 CTGCAGTAACCAAAAGAGCATGG + Intergenic
1153074908 18:1150935-1150957 CTATAGTAACCAAAAGAGCATGG - Intergenic
1153081519 18:1231734-1231756 CTATAGTAACCAAAACAACATGG - Intergenic
1153088792 18:1319860-1319882 CTATAGTAACCAAAAGAGCATGG + Intergenic
1153091822 18:1355570-1355592 ATGTAGTAATCAAGAAAACATGG + Intergenic
1153149624 18:2076874-2076896 CTGTAGTAATCAAAATAACATGG + Intergenic
1153553982 18:6291458-6291480 CTATAGTAACCAAATCAGCATGG + Intronic
1153714492 18:7832999-7833021 CTATAGTAACCAAAAGAACATGG - Intronic
1153784178 18:8519705-8519727 ATTTAGTAGGAAAATGAACAAGG + Intergenic
1154068513 18:11131474-11131496 ATGTAGGCACCATGTGAACATGG + Intronic
1154512013 18:15115602-15115624 CTATAGTAACCAAATCAACATGG - Intergenic
1154944925 18:21152675-21152697 CTATAGTAACCAAATCAGCATGG - Intergenic
1155102039 18:22620977-22620999 CTGCAGTAACCAAATCAGCATGG + Intergenic
1156344968 18:36248822-36248844 CTGTAGTAACCAAAACAGCATGG - Intronic
1156426197 18:37015378-37015400 ATATAGTAACCAAAACAGCACGG - Intronic
1157055610 18:44224941-44224963 CTGTAGTAACCAAAACAGCATGG - Intergenic
1157268016 18:46245813-46245835 AAGTAGTAACTAAATTATCATGG - Intronic
1158070438 18:53463654-53463676 ATGAAGTAACCAAATTAAGAAGG + Intronic
1158819367 18:61141705-61141727 ATGTTATAACTAAATGAATATGG + Intergenic
1158896385 18:61917954-61917976 CTCTAGCAACCAAATTAACAGGG + Intergenic
1159294205 18:66461006-66461028 CTATAGTAACCAAAATAACAAGG - Intergenic
1159416610 18:68157619-68157641 CTATAGTAACCAAAACAACATGG - Intergenic
1160865720 19:1255105-1255127 ATGTAGACCCCAAATGCACAGGG - Intronic
1166001736 19:39881548-39881570 ATGTAGTAACTGTACGAACAGGG - Intronic
1166004518 19:39897799-39897821 ATGTAGTAACTGTACGAACAGGG - Intronic
1166026224 19:40087770-40087792 CTATAGTAACCAAAACAACAAGG + Intronic
1166146578 19:40841408-40841430 CTATAGTAACCAAAACAACAAGG - Intronic
1166150624 19:40872018-40872040 CTATAGTAACCAAAACAACAAGG - Intronic
1166250684 19:41568666-41568688 CTATAGTAACCAAATCAGCATGG - Intronic
924997745 2:379237-379259 CTGTAGTAACCAAAATAGCATGG + Intergenic
925657705 2:6167099-6167121 CTGTATTATCCAAATGGACATGG + Intergenic
926708287 2:15853123-15853145 CTGTAGTAACCAAAACAGCATGG - Intergenic
928620012 2:33079248-33079270 ATGGAGAAAACAAATGAATAAGG + Intronic
928744210 2:34392271-34392293 ATGCAGGAACCAAATCTACATGG + Intergenic
928955563 2:36863551-36863573 CTGTAGTAACCAAAACATCATGG - Intronic
929435036 2:41922405-41922427 TTGTAGATACCAAATAAACAAGG + Intergenic
930182204 2:48371489-48371511 CTGTAGTAACCAAAAAAGCAAGG - Intronic
930254427 2:49073799-49073821 CTATAGTAACCAAAACAACAAGG + Intronic
930291277 2:49496207-49496229 CTGTAGTAACCAAAACAACATGG + Intergenic
930309555 2:49722151-49722173 ATGTAGAATACAAATGAAAACGG + Intergenic
930412903 2:51049159-51049181 CTGTAGTAACCAAAACAACATGG - Intergenic
930474313 2:51860551-51860573 ATATAGTAACCAAAACAGCATGG - Intergenic
930481976 2:51959974-51959996 ATGTAGTAAGCAAATATAGAAGG + Intergenic
930495651 2:52138613-52138635 ATGTAGTAAGAAAATGGAAATGG + Intergenic
930527186 2:52544771-52544793 CCGTAGTAACCAAAACAACATGG - Intergenic
930948007 2:57099375-57099397 CTTTAGTAACCAAAAGAGCATGG - Intergenic
930970873 2:57394550-57394572 GTATAGTAACCAAAACAACATGG - Intergenic
931345542 2:61441885-61441907 CTGTAGTAACCAAAACAGCATGG + Intronic
931406270 2:61981523-61981545 ATACAGTAACCAAAACAACATGG - Intronic
931451957 2:62375467-62375489 TTGTAGTAACCAAAACAACGTGG + Intergenic
931530190 2:63205222-63205244 CTATAGTAACCAAAACAACATGG - Intronic
932223336 2:70018535-70018557 CTGTAGTAACCAAAACAGCATGG + Intergenic
932537562 2:72616389-72616411 CTATAGTAACCAAGTGAGCAGGG + Intronic
932806445 2:74787780-74787802 CTATAGTAACCAAAACAACATGG - Intergenic
933135067 2:78723929-78723951 CTATAGTAACCAAAAGAGCATGG - Intergenic
933489281 2:82964943-82964965 ATATAGTAACCAAAATAGCATGG - Intergenic
933607300 2:84396652-84396674 ATGTACTAATTACATGAACAAGG - Intergenic
934306612 2:91828838-91828860 CTGTAGTAACCAAAACATCATGG - Intergenic
934326644 2:92023904-92023926 CTGTAGTAACCAAAACATCATGG + Intergenic
934465014 2:94254455-94254477 CTGTAGTAACCAAAACATCATGG + Intergenic
934875113 2:97910822-97910844 CTATAGTAACCAAAACAACATGG - Intronic
935290404 2:101605712-101605734 CTGTAGTAACCAGAACAACATGG + Intergenic
936005894 2:108887261-108887283 ATATAGTAACCAAAACAGCATGG - Intergenic
936830411 2:116638328-116638350 CTGTAGTAACTAAAAGAACATGG + Intergenic
936906663 2:117544161-117544183 ATGTATTAACCATATGACCTAGG + Intergenic
937403103 2:121602568-121602590 CTGTAGTAACCAAAACAACCTGG + Intronic
937552959 2:123117470-123117492 CTATAGTAACCAAATCAGCATGG - Intergenic
937561251 2:123226782-123226804 CTGCAGTAACCAAATCAGCATGG - Intergenic
937591737 2:123621654-123621676 ATATAGTAACCAAAACATCATGG + Intergenic
937823536 2:126339434-126339456 ATATAGTAACCAAACCAGCATGG + Intergenic
938261594 2:129899831-129899853 CTATAGTAACCAAATCAGCATGG + Intergenic
938312047 2:130299563-130299585 CTATAGTAACCAAAGCAACATGG + Intergenic
939655666 2:144820920-144820942 CTGTAGTAACCAAAACAGCATGG - Intergenic
939800842 2:146705859-146705881 CTGTAGTAACCAAAATAGCATGG + Intergenic
939909911 2:147967908-147967930 CTGTAGTAACCAAAACAGCATGG + Intronic
940027294 2:149221794-149221816 ATATTGCAAACAAATGAACATGG + Intergenic
940175925 2:150877774-150877796 ATGTAGTTACCAAAAGGAAAAGG + Intergenic
940476841 2:154173088-154173110 CTGTAGTAACCAAATCAGCATGG + Intronic
940574153 2:155478547-155478569 CTGTGGTAACCAAAACAACATGG + Intergenic
940861495 2:158774647-158774669 GTGATGTAACCATATGAACATGG - Intergenic
941075159 2:160998878-160998900 CTATAGTAACCAAAAGAGCATGG - Intergenic
941170560 2:162130774-162130796 CTGTAGTAACCAAAACAGCATGG - Intergenic
941338770 2:164279240-164279262 CTGTAGTAACCAAAATAGCATGG - Intergenic
941348457 2:164401011-164401033 CTATAGTAACCAAAACAACACGG + Intergenic
941435061 2:165459867-165459889 CTGTAGTAACCAAATCAGCATGG - Intergenic
942971801 2:181965683-181965705 CTGTAGTAACCAAAACAGCATGG - Intronic
943138194 2:183942633-183942655 CTATAGTAACCAAAGCAACATGG + Intergenic
943606157 2:189979192-189979214 CTATAGTAACCAAAACAACATGG + Intronic
944308656 2:198206914-198206936 CTATAGTAACCAAAACAACATGG - Intronic
944384361 2:199148129-199148151 TGGTAGAAACCAAATAAACATGG + Intergenic
945636408 2:212357768-212357790 ATGTAGTAACCAAGTGACCGTGG - Intronic
945713832 2:213333613-213333635 ATATAGTAACCAAAACAACATGG + Intronic
945844211 2:214924457-214924479 CTATAGTAACCAAAAGAGCATGG - Intergenic
946205474 2:218103962-218103984 CTATAGTAACCAAATCAGCATGG - Intergenic
946874894 2:224118701-224118723 CTGTAGTTACCAAAACAACATGG + Intergenic
947039621 2:225902024-225902046 CTATAGTAACCAAAAGAGCATGG + Intergenic
947131415 2:226930268-226930290 ATGTAGTAACTAAAACAGCATGG + Intronic
947457903 2:230272704-230272726 ATACAGTAACCAAATCAAGATGG + Intronic
947552991 2:231060752-231060774 ATTTAGTCATCAAATCAACAAGG - Intronic
948927363 2:241107888-241107910 ATGTAGGCACCAAGTCAACAGGG + Intronic
1169313301 20:4566712-4566734 ATGTAGTACACAAATATACATGG + Intergenic
1169500241 20:6152892-6152914 CTATAGTAACCAAAACAACATGG - Intergenic
1169635567 20:7687922-7687944 CTATAGTAACCAAAACAACAGGG - Intergenic
1170146200 20:13177522-13177544 CTGTAGTAACCAAAACATCATGG + Intergenic
1170456132 20:16534880-16534902 CTGTAGTAACCAAAACAGCATGG - Intronic
1170862244 20:20117468-20117490 AGATAGTAACCAAATTAGCATGG - Intronic
1170908755 20:20542520-20542542 ATATAGTAACCAAAACAGCATGG + Intronic
1171132911 20:22671459-22671481 CTGTAATAACCAAATCAGCATGG + Intergenic
1171254298 20:23676008-23676030 CTGTAGTAACCAAAACAGCACGG - Intergenic
1171269920 20:23807131-23807153 CTGTAGTAACCAAAACAGCATGG - Intergenic
1171781721 20:29425096-29425118 CTGTAGTAACCAAAACAGCATGG + Intergenic
1172383777 20:34518241-34518263 GTATAGTAACCAAAAGAGCATGG - Intronic
1172598447 20:36167068-36167090 ATGCTGTAACCAAAAAAACAGGG + Intronic
1173230199 20:41189220-41189242 CTATAGTAACCAAAACAACATGG - Intronic
1174092611 20:48061289-48061311 AAGAGGTAACCAAATGTACAAGG + Intergenic
1174371165 20:50089149-50089171 ATGTAATAACGAAATGAAGCAGG + Intronic
1174847433 20:53956367-53956389 AAGGAGTAACCAAATCAGCAGGG - Intronic
1175480344 20:59306223-59306245 ATGTAGTTATGAAAAGAACAGGG + Intronic
1175512337 20:59538517-59538539 CTATAGTAACCAAATTAGCATGG - Intergenic
1175747640 20:61469940-61469962 CTATAGTAACCAAATTAGCATGG - Intronic
1176596048 21:8697674-8697696 CTGTAGTAACCAAAACATCATGG + Intergenic
1176939405 21:14905754-14905776 CTGTAGTAACCAAACCAGCAAGG - Intergenic
1177098994 21:16876222-16876244 CTGTAGTAACTAAATCAGCATGG + Intergenic
1177240261 21:18446560-18446582 CTATAGTAACCAAATAAGCATGG + Intronic
1177261532 21:18735200-18735222 TTATAGTAACCCAAAGAACACGG - Intergenic
1177924221 21:27194039-27194061 ATATAGTAACCAAAACAGCATGG + Intergenic
1177974851 21:27835435-27835457 CTATAGTAACCAAAACAACATGG - Intergenic
1177979888 21:27899551-27899573 CTATAGTAACCAAATCAACATGG + Intergenic
1178004307 21:28199123-28199145 ATATAGTAACCAAAACAGCAGGG + Intergenic
1180034744 21:45240209-45240231 CTGTAGTAACCAAACCAGCATGG + Intergenic
1180261165 21:46670009-46670031 ATGAAGTAACTAAATGAATCTGG + Intergenic
1180278961 22:10675123-10675145 CTGTAGTAACCAAAACATCATGG + Intergenic
1180586166 22:16893651-16893673 CTGTAGTAACCAAAACATCACGG + Intergenic
1181807141 22:25381828-25381850 ATGCAGTCATCAAAAGAACAGGG - Intronic
1182608391 22:31525837-31525859 CTGTAGTAACCAAAACAGCATGG - Intronic
1182699025 22:32217891-32217913 GTATAGTAAACAAATGAAAATGG - Intergenic
1183461388 22:37953105-37953127 AGGTAGTGACCAAAGGAACTGGG - Exonic
1184832987 22:47002261-47002283 ATGTAAAAACAAAATGTACAGGG - Intronic
1184908346 22:47508006-47508028 CTGTAGTAACCAAAACAGCATGG + Intergenic
1185007020 22:48285462-48285484 ATGCAGTAATCAAAAGAGCATGG + Intergenic
949145555 3:695474-695496 ATATAGTTACCAAAACAACATGG - Intergenic
949268446 3:2187308-2187330 ATATAGTAACCAAAACAGCATGG - Intronic
949299647 3:2568993-2569015 ATGTCTTAAGCAAATGATCAGGG - Intronic
949622695 3:5832716-5832738 ATATGGTAACCAAAACAACAGGG - Intergenic
949711039 3:6871626-6871648 ATCTGGTAGCCAAATGAAAATGG - Intronic
950048083 3:9963210-9963232 ATGTAGGCTCAAAATGAACAGGG + Exonic
950775542 3:15346736-15346758 ATATAGTAAACAAATGAATGTGG - Intergenic
950944520 3:16930905-16930927 ATGGAGTAGTCAAATGTACACGG - Intronic
951124882 3:18971671-18971693 TTGTAGTAACCAAAACAGCATGG - Intergenic
951285312 3:20804687-20804709 CTATAGTAACCAAAACAACATGG - Intergenic
951287364 3:20830347-20830369 ATTAAATAACAAAATGAACAAGG - Intergenic
951480378 3:23155125-23155147 CTGTAGTAACCAAAACAGCATGG + Intergenic
952089947 3:29872974-29872996 CTATAGTAACCAAAAGAGCATGG - Intronic
952493351 3:33893344-33893366 CTGTAGTCACCAAAAGAGCATGG - Intergenic
952592483 3:34974061-34974083 CTATAGTAACCAAATCAGCATGG - Intergenic
952729833 3:36627071-36627093 ATGCAGTGGCCAAATGAACATGG + Intergenic
952769053 3:36980798-36980820 CTGTAGTAACCAAATTAGCATGG - Intergenic
953258699 3:41316001-41316023 ATATAGTTACCAAATGACCCAGG + Intronic
953270478 3:41438030-41438052 AAATAGTAAACAAATGAACTAGG - Intronic
953937833 3:47061268-47061290 CTATAGTAACCAAAACAACATGG + Intronic
954102792 3:48390078-48390100 CTATAATAACCAAATTAACATGG - Intronic
954487479 3:50866810-50866832 CTATAGTAACCAAAAGAGCATGG - Intronic
955584861 3:60465770-60465792 ATATAGTAACCAAAACAGCATGG - Intronic
955823016 3:62916346-62916368 CTGCAGTAACCAAAACAACATGG - Intergenic
956371453 3:68567160-68567182 CTATAGTAACCAAAACAACATGG - Intergenic
957083786 3:75661261-75661283 CTGTAGTAACCAAAACAACATGG - Intergenic
957217050 3:77334187-77334209 AGGTAGTAGCCAAAGAAACAGGG + Intronic
957751052 3:84416274-84416296 CTATGGTAACCAAATTAACATGG + Intergenic
957755833 3:84486051-84486073 CTGTAGTTACCAAATCAAAATGG - Intergenic
957760059 3:84543912-84543934 CTGTAGTAACCAAAGCAGCATGG - Intergenic
958530540 3:95324475-95324497 CTGTAGTTACCAAAACAACATGG - Intergenic
958607993 3:96385075-96385097 CTATAGTAACCAAAACAACATGG - Intergenic
958613643 3:96460850-96460872 CTTTAGTAACCAAATCAGCATGG + Intergenic
958686247 3:97400333-97400355 ATATAGTAACCAAAGCAGCATGG - Intronic
959229146 3:103625028-103625050 CCATAGTAACCAAATAAACATGG - Intergenic
959250167 3:103931585-103931607 CTGCAGTAACCAAAACAACATGG - Intergenic
959307072 3:104680998-104681020 CTACAGTAACCAAATCAACATGG + Intergenic
959680020 3:109084756-109084778 TTATAGTAACCAAATCAGCATGG + Intronic
960206968 3:114913961-114913983 CTATAGTAACCAAAAGAGCATGG - Intronic
960283928 3:115806650-115806672 ATGTAGTAAAAAAATGCCCATGG + Exonic
960302430 3:116020127-116020149 ATCTAGCAACATAATGAACATGG + Intronic
960444074 3:117726023-117726045 ATGTAGGAAAAAAATAAACAGGG + Intergenic
960478158 3:118157120-118157142 CTATAGTAACCAAAACAACATGG + Intergenic
960480609 3:118183701-118183723 CTGTAGTAACCAAAACAGCATGG - Intergenic
960731627 3:120733931-120733953 CTGTAGTAACCAAAACAGCATGG - Intronic
961321513 3:126079840-126079862 CTGTAGTAACCAAATCAGCATGG + Intronic
962497369 3:135954826-135954848 CTATAGTAACCAAATCAGCATGG - Intergenic
962689089 3:137875464-137875486 CTGTAGTAACCAAAACAACATGG + Intergenic
963020227 3:140866140-140866162 CTGTAGTAACCAAAACAGCATGG - Intergenic
963671899 3:148261452-148261474 ATTTAGTAGCCTAAAGAACAGGG + Intergenic
964178118 3:153850541-153850563 ATGTAAGAGCCAAATGAAAAAGG - Intergenic
964250045 3:154703625-154703647 ATGTAGTAACCAGATCAATTAGG + Intergenic
964438738 3:156681186-156681208 ATGTGGTAACCATGTGAACCTGG - Intronic
964501213 3:157350129-157350151 CTGTAGTAACCAAAACAACATGG + Intronic
964589627 3:158345962-158345984 ATATAGTACCCAAATAAAAAAGG + Intronic
964801329 3:160562455-160562477 ATGTAGTAACCATATCTAAAGGG + Intronic
965014316 3:163137051-163137073 CTATAGTAACCAAAGCAACATGG - Intergenic
965151237 3:164978130-164978152 CTATAGTAACCAAAAGAGCATGG - Intergenic
965228196 3:166018897-166018919 CTATAGTAACCAAAACAACATGG - Intergenic
965293447 3:166913593-166913615 TTATAGTAACCAAAACAACATGG - Intergenic
965629701 3:170719905-170719927 CTGTAGTAACCAAAATAACATGG + Intronic
966108883 3:176372707-176372729 TTGTAGTAACCAAAACATCATGG + Intergenic
966138187 3:176724980-176725002 CTCTAGTAACCAAAACAACATGG - Intergenic
966265436 3:178036046-178036068 CTGTAGTAACCAAAACATCATGG - Intergenic
966513738 3:180793833-180793855 CTATAGTAACCAAATCAGCATGG - Intronic
966515119 3:180811420-180811442 ATGTAGGAACAAAGAGAACATGG - Intronic
967677923 3:192322607-192322629 ATATAGTAACCAAAACAACATGG + Intronic
970067201 4:12111814-12111836 ATATAGTAACCAAAACAGCATGG - Intergenic
970416118 4:15858686-15858708 TTATAGTAACCAAAACAACATGG + Intergenic
970442921 4:16099451-16099473 ATATAGTAACCAAAATAGCATGG + Intergenic
970616878 4:17776039-17776061 ATATAGTAAACAAATAAATAAGG + Intronic
970675450 4:18443479-18443501 GTGTAGTAACCTAATGAATTTGG - Intergenic
971020186 4:22527368-22527390 ATGTAGTGAACAGATGAAAATGG - Intergenic
971085665 4:23272179-23272201 ATTTAGAAACCAAAAAAACATGG - Intergenic
971229978 4:24793830-24793852 ATGTTGTTACCAAAGGAAGAGGG + Intronic
971530972 4:27688386-27688408 CTGTAGTAACCAAAACAGCATGG - Intergenic
971586586 4:28412015-28412037 CTGTAGTAACCAAAACAGCATGG + Intergenic
971747106 4:30596657-30596679 ATGTTGTAAAAAAATAAACAGGG - Intergenic
972043287 4:34631658-34631680 CTTTAGTAACCAAAACAACATGG + Intergenic
972225880 4:37011293-37011315 CTGTAGTAACCAAAACAGCATGG + Intergenic
972884377 4:43467358-43467380 ATATAGTAACCAAAACAGCATGG - Intergenic
972996739 4:44888628-44888650 ATATAGTAACCAAAACAGCATGG - Intergenic
973105106 4:46325951-46325973 CTGCAGTAACCAAAACAACATGG - Intronic
973563089 4:52156224-52156246 ATGCAGTAACCAAAACAGCATGG + Intergenic
973694256 4:53474621-53474643 CTGTAGTAACAGAATAAACATGG - Intronic
973922081 4:55697391-55697413 CTGTAGTAACCAAAACAGCATGG - Intergenic
973922082 4:55697438-55697460 CTGTAGTAACCAAAACAGCATGG + Intergenic
974518156 4:62943278-62943300 CTATAGTAACCAAAGGAGCATGG - Intergenic
974901547 4:68005517-68005539 CTATAGTAACCAAAACAACATGG + Intergenic
974979660 4:68939309-68939331 CTGCAGTAACCAAAACAACATGG + Intronic
974997267 4:69176840-69176862 CTGTAGTAACCAAAACAACATGG + Intronic
975091380 4:70408326-70408348 ATATCATAAACAAATGAACAAGG - Intronic
975346480 4:73298230-73298252 CTATAGTAACCAAATCATCATGG + Intergenic
975481631 4:74887246-74887268 CTGTAGTAACCAAAACAGCATGG + Intergenic
975501747 4:75093984-75094006 TTGTAGTAACCAAAACAGCATGG - Intergenic
975977394 4:80115214-80115236 CTGTAGTAACCAAAACAGCATGG - Intronic
976031746 4:80763716-80763738 CTGTAGTAACCAAAACAGCATGG + Intronic
976171825 4:82312026-82312048 CTGTAGTTACCAAAACAACATGG + Intergenic
976450958 4:85190393-85190415 CTATAGTAACCAAAACAACATGG - Intergenic
976773760 4:88684227-88684249 CTATAGTAACCAAAACAACATGG + Intronic
976890734 4:90044181-90044203 ACGAAGTAATCAAATTAACAAGG - Intergenic
977036986 4:91966310-91966332 TTATAGTAACCAAAACAACATGG - Intergenic
977077566 4:92475552-92475574 CTATAGTAACCAAAGCAACATGG - Intronic
977087299 4:92618389-92618411 CTGTAGTAACCAAAACAGCAGGG - Intronic
977467958 4:97405275-97405297 ATGTACTAAGTACATGAACAAGG + Intronic
977562857 4:98550263-98550285 CTATAGTAACCAAAACAACATGG - Intronic
977822491 4:101490458-101490480 ATACAGTAACCAAAAGAGCATGG - Intronic
977834044 4:101628084-101628106 CTGTAGTTACCAAAACAACATGG - Intronic
978163327 4:105576027-105576049 CTGTAGTTACCAAAACAACATGG - Intronic
979012102 4:115385349-115385371 ATATAGTAACCAAAATAGCATGG - Intergenic
979138382 4:117140296-117140318 CTGTAGTAATCAAAACAACATGG + Intergenic
979599022 4:122566283-122566305 CTGTAGTAACCAAAACAGCATGG - Intergenic
979628105 4:122869216-122869238 CTGCAGTAACCAAAACAACATGG - Intronic
980235228 4:130096864-130096886 CTGTAGTAACTAAATCAGCATGG + Intergenic
980333173 4:131435909-131435931 CTGCAGTAACCAAAACAACATGG - Intergenic
980701535 4:136438296-136438318 ATGAAGTAAAAAAATGAAAAAGG - Intergenic
981159306 4:141477932-141477954 CTATAGTAACCAAATTAGCATGG - Intergenic
981256677 4:142669424-142669446 CTGTAGTAACCAAAACAGCATGG + Intronic
981297668 4:143150881-143150903 CTATAGTAACCAAAAGAGCATGG - Intergenic
981564472 4:146084308-146084330 CTATAGTAACCAAAGCAACATGG - Intergenic
981870664 4:149481632-149481654 CTATGGTAACCAAAAGAACATGG - Intergenic
982785258 4:159529403-159529425 ATGTAATAACCAAAACAGCATGG - Intergenic
982933094 4:161434163-161434185 CTGTAGTAACCAAAACAGCATGG + Intronic
985221388 4:187709345-187709367 CTATAGTAACCAAATCAACATGG + Intergenic
985447739 4:190035619-190035641 CTGTAGTAACCAAAACAGCATGG + Intergenic
986244475 5:5993431-5993453 ATATAGTAACCAAAACAACATGG - Intergenic
986757040 5:10847196-10847218 CTGTAGTAACCAAAACAGCATGG + Intergenic
987518774 5:18951370-18951392 CTGTAGTAACCAAAACAGCATGG + Intergenic
987583910 5:19829797-19829819 CTATAGTAACCAAAACAACATGG + Intronic
987618130 5:20303570-20303592 TTGTTGTTACCAAATGAACCGGG - Intronic
987870316 5:23609209-23609231 CTCTAGTAACCAAAACAACATGG - Intergenic
987992445 5:25231300-25231322 TTATAGTAACCAAATCAGCATGG + Intergenic
988420753 5:31003019-31003041 CTGTAGTCACCAAATCAGCAGGG - Intergenic
988435925 5:31175301-31175323 ATGAAGTAAGGAAATAAACATGG - Intergenic
988925414 5:35985468-35985490 GTATAGTAACCAAATCAGCACGG + Intronic
989297377 5:39845626-39845648 CTATAGTAACCAAAAGAGCATGG - Intergenic
989489610 5:42034744-42034766 ATATAGTAACCAAAACAGCATGG - Intergenic
990843641 5:60112095-60112117 AAGTAGAATCCAAATGAACCAGG + Intronic
991011662 5:61889233-61889255 CTATAGTAACCAAATCAGCATGG + Intergenic
991160861 5:63500481-63500503 CTATAGTAACCAAAACAACATGG - Intergenic
991169168 5:63600867-63600889 CTGTAGTAACCAAAAGAGCATGG - Intergenic
991318742 5:65343304-65343326 CTGCAGTAACCAAAACAACATGG + Intronic
992344006 5:75857489-75857511 CTATAGTAACCAAAACAACATGG - Intergenic
993076315 5:83236326-83236348 TTGTAGTAACCAAAAGAGCATGG + Intronic
993191456 5:84687748-84687770 ACATAGTAACCAAAAGAGCATGG + Intergenic
993228148 5:85196375-85196397 ATGTCATAAACAAATGAACAAGG - Intergenic
993286148 5:85999983-86000005 CTGTAGTAACCAAAACAGCATGG + Intergenic
993430266 5:87824274-87824296 TTTTAGTAACAAAATGCACAGGG + Intergenic
993433459 5:87861597-87861619 CTGTAGTTACCAAAACAACATGG + Intergenic
993593202 5:89821713-89821735 CTGCAGTAACCAAATCAGCATGG - Intergenic
993621859 5:90178095-90178117 CTATAGTAACCAAAAGAGCATGG + Intergenic
993797758 5:92289566-92289588 CTCCAGTAACCAAAAGAACATGG - Intergenic
993913517 5:93712816-93712838 CTATAGTAACCAAAACAACATGG + Intronic
994138298 5:96314019-96314041 ATGCAGTACCCAAATATACATGG + Intergenic
994226622 5:97259337-97259359 CTATAGTAACCAAAACAACATGG + Intergenic
994443260 5:99837156-99837178 ATGCAATAACCAAATCATCATGG - Intergenic
994654416 5:102572386-102572408 CTGTAGTAACCAAAAGAGCATGG + Intergenic
994940525 5:106317766-106317788 ATATAGTAACCAAAACAGCATGG - Intergenic
995318900 5:110808505-110808527 AGGTAGTAACCATATAATCAGGG + Intergenic
995545982 5:113231548-113231570 CTGTAGGAACAAAGTGAACATGG - Intronic
995606034 5:113856074-113856096 TTATAGTAACCAAATCAGCATGG - Intergenic
995640984 5:114257239-114257261 GTGTAGTAACCAAAACAGCATGG - Intergenic
995777588 5:115740916-115740938 ATATAGTAACCAAAACAGCATGG - Intergenic
996103398 5:119469662-119469684 ATGTAGGAACAAAAGAAACATGG - Intronic
996958418 5:129213316-129213338 CTATAGTAACCAAAAGAGCATGG - Intergenic
997060371 5:130494152-130494174 CTGTAGTAACCAAAACAGCATGG + Intergenic
997143660 5:131409520-131409542 GTATAGTAACCAAAAGAACATGG + Intergenic
997421500 5:133771103-133771125 CTGTAGTAACCAAAACAGCATGG - Intergenic
998047170 5:138997539-138997561 CTGTAGTGACCAAATCAGCATGG - Intronic
998181255 5:139945530-139945552 CTGTAGTAACCAAAACAGCATGG - Intronic
998289671 5:140901580-140901602 ATATAGTAACCAAAACATCATGG - Intronic
998550336 5:143071236-143071258 CTGTAGTAACCAAAGCAGCATGG + Intronic
1000271740 5:159691360-159691382 CTATAGTAACCAAAACAACATGG - Intergenic
1000581944 5:163046138-163046160 CTATAGTAACCAAAACAACATGG + Intergenic
1001165216 5:169359029-169359051 CTGTAGTAACCAAAACAGCAAGG + Intergenic
1001873809 5:175181987-175182009 TTGTAGTAATGAAATGAACCTGG + Intergenic
1001925741 5:175635283-175635305 GTTTAGTAACCAAAACAACATGG + Intergenic
1003775575 6:9358704-9358726 CTGTAGTAACCAAATAAGCATGG + Intergenic
1004109641 6:12704411-12704433 CTGTAATAACCAAAAGAGCATGG + Intergenic
1005593543 6:27353641-27353663 CTGTAGTAACCAAAGCAGCATGG + Intergenic
1005855357 6:29857747-29857769 TTATAGTAACCAAATCAGCATGG + Intergenic
1006265360 6:32917472-32917494 CTATAGTAACCAAAACAACATGG - Intergenic
1007135641 6:39519430-39519452 ATGTAGCAACAAAATGTTCAAGG + Intronic
1008100561 6:47386001-47386023 CTGTAGTAACCAAAACAACATGG - Intergenic
1008186343 6:48395702-48395724 CTACAGTAACCAAAAGAACATGG - Intergenic
1008339739 6:50349935-50349957 ATGTTATAACCAAATGCTCATGG + Intergenic
1008352096 6:50504157-50504179 TTATAGTAACCAAAACAACATGG + Intergenic
1008357901 6:50576832-50576854 CTATAGTAACCAAAAGAGCATGG + Intergenic
1008404308 6:51101577-51101599 CTACAGTAACCAAAAGAACATGG - Intergenic
1008640807 6:53460723-53460745 ATATAGTAACCAAAGCAGCATGG + Intergenic
1008707060 6:54175128-54175150 CTATAGTAACCAAAACAACATGG - Intronic
1008731449 6:54487432-54487454 CTATAGTAACCAAAAGAGCATGG - Intergenic
1008795440 6:55297263-55297285 CTATAGTAACCAAAACAACATGG - Intergenic
1008882236 6:56393111-56393133 CTATAGTAACCAAAACAACATGG + Intronic
1008943073 6:57068566-57068588 ATGTAGAAAGCAAATGAACCTGG - Intergenic
1009477967 6:64118298-64118320 CTATAGTAACCAAAACAACATGG + Intronic
1009620984 6:66077084-66077106 ATGTACTAACCAAAATAATATGG - Intergenic
1009783872 6:68305715-68305737 CTGTAGTAACCAAAATAGCATGG + Intergenic
1009803153 6:68568415-68568437 CTGTAGTAACCAAAACAGCATGG - Intergenic
1010182340 6:73102010-73102032 ATATAGTAACCAAAACAAAATGG + Intronic
1010333405 6:74651421-74651443 TTTTAGTAACCAAATCAGCATGG - Intergenic
1010501229 6:76602814-76602836 CTGCAGTAACCAAAACAACATGG + Intergenic
1010728463 6:79362321-79362343 ATACAGTAACCAAAAGAGCATGG - Intergenic
1010848324 6:80740300-80740322 GTGTTGTAACCAAAACAACATGG - Intergenic
1010862703 6:80933148-80933170 CTGTAGTCACCAAAAGAGCATGG - Intergenic
1011238797 6:85248149-85248171 ATATAGTAACCAAAACAACATGG - Intergenic
1011446798 6:87450196-87450218 CTATAGTAACCAAAAGAGCATGG - Intronic
1011503493 6:88016086-88016108 CTATAGTAACCAAAACAACATGG - Intergenic
1012015969 6:93852090-93852112 CTATAGTAACCAAAACAACATGG - Intergenic
1012056849 6:94423683-94423705 CTGTAGTAACCAAAACAGCATGG - Intergenic
1012079772 6:94741496-94741518 CTGTAGTTACCAAAAGAGCATGG + Intergenic
1012212947 6:96546626-96546648 CTATAGTAACCAAAACAACATGG + Intronic
1012303057 6:97613620-97613642 CTGTAGTAACCAAAACAGCAAGG - Intergenic
1012600199 6:101087253-101087275 CTGTAGTAACCAAAACAGCATGG - Intergenic
1012782962 6:103586467-103586489 ATATAGTAACCAAAACAGCATGG - Intergenic
1012989852 6:105914261-105914283 CTATAGTAACCAAAACAACATGG - Intergenic
1013223116 6:108097383-108097405 ATATAGTAACCAAAACAGCATGG + Intronic
1013568507 6:111395016-111395038 CTTTAGTAACCAAATCAGCATGG - Intronic
1013949460 6:115762305-115762327 ATAAATTAACCAAATGAAAATGG + Intergenic
1014747483 6:125217016-125217038 ATTTAATAAACAAATGAAAATGG - Intronic
1015193862 6:130504066-130504088 CTGTAGTAACCAAAATAGCATGG + Intergenic
1015834684 6:137407536-137407558 CTATAGTAACCAAAAGAGCATGG - Intergenic
1016531555 6:145064078-145064100 ATGTAGTAACTAAATATTCATGG + Intergenic
1016692701 6:146956758-146956780 ATGTAAAGACCAGATGAACAAGG + Intergenic
1016813852 6:148285753-148285775 ATGTTCTAACCAAATGAGAAAGG + Intronic
1016835921 6:148476825-148476847 CTGTAGTAACCAAAACAGCATGG + Intronic
1016948673 6:149559154-149559176 ATATAGTAACCAAAACAGCATGG + Intergenic
1017330066 6:153186872-153186894 CTATAGTAACCAAAACAACATGG - Intergenic
1017365914 6:153637293-153637315 CTTTAGTAACCAAAACAACATGG - Intergenic
1017396856 6:154010849-154010871 ATGTAGCAACCACAAGAACAAGG - Exonic
1017568783 6:155718749-155718771 CTATAGTAACCAAATCAGCATGG + Intergenic
1018348595 6:162929959-162929981 CTATAGCAACCAAATGAGCATGG - Intronic
1019098291 6:169605720-169605742 TTATAGTAACCAAAACAACATGG + Intronic
1019850826 7:3555193-3555215 CTATAGTAACCAAAACAACATGG + Intronic
1020706536 7:11550957-11550979 CTGTAGTAACCAAAACAGCACGG + Intronic
1020915995 7:14193308-14193330 ATATAGTAACCAAAACAACATGG + Intronic
1021021871 7:15609997-15610019 ATGTAGTAAGAAAATGAAATAGG - Intergenic
1021325359 7:19259742-19259764 CTATAGTAACCAAAGCAACATGG + Intergenic
1021376207 7:19910152-19910174 CTGTAGTAACTAAAACAACATGG + Intergenic
1021590266 7:22253842-22253864 ATGTATTTACCAAAGGATCAAGG + Intronic
1021605827 7:22408554-22408576 CTGTAGTAACCAAAATATCATGG + Intergenic
1021641378 7:22740795-22740817 CTGTAGTAACCAAAAGAACATGG + Intergenic
1021770007 7:23990045-23990067 CTGTAGTAACCAAAACAATATGG + Intergenic
1023452065 7:40297168-40297190 ATGTAGTAATAAGGTGAACATGG - Intronic
1024405390 7:48973532-48973554 CTGCAGTAACCCAAAGAACATGG + Intergenic
1024662657 7:51513025-51513047 ATGTAGTAAACAAAATAACATGG - Intergenic
1024964109 7:55006269-55006291 ATGGAGTATCCAAATGAACAGGG - Intergenic
1027341643 7:77214812-77214834 CTGTAGTAACCAAAATAGCACGG - Intronic
1027407295 7:77875000-77875022 CTATAGTAACCAAAAGACCATGG - Intronic
1027558999 7:79703695-79703717 ATACAGTAACCAAATCAGCATGG + Intergenic
1027587181 7:80073169-80073191 CTGTAGTAACCAAAACAGCATGG + Intergenic
1027826497 7:83123234-83123256 CTGTAGTAACCAAAACAGCATGG + Intronic
1028161282 7:87488106-87488128 ATTTATTAAACAAATGAAAATGG + Intergenic
1028262857 7:88686180-88686202 GTTTATTAACCAAATAAACATGG - Intergenic
1028299177 7:89175453-89175475 ATATAGCAACCAAAAGAGCATGG - Intronic
1028836051 7:95376423-95376445 AAGGAGAAACCAAAAGAACAAGG + Intronic
1029888512 7:103900558-103900580 CTATAGTAACCAAAACAACATGG + Intronic
1030312731 7:108084327-108084349 ATGTAAGAAGCAAATGGACAGGG + Intronic
1030734021 7:113022723-113022745 CTGTAGTAACCAAAACAGCATGG - Intergenic
1030734056 7:113023444-113023466 AGCTAGTAACAAACTGAACAGGG - Intergenic
1031065714 7:117103363-117103385 TTATAGTAACCAAATCAGCATGG + Intronic
1031128322 7:117801089-117801111 ATGTAATAAACAAGTAAACAGGG + Intronic
1031289244 7:119911321-119911343 GTATAGTAACCAAAACAACATGG - Intergenic
1031788306 7:126063762-126063784 CTATAGTAACCAAAAGAGCATGG + Intergenic
1032337601 7:131040871-131040893 ATTTGGTAACAAAAAGAACAGGG - Intergenic
1033362174 7:140645421-140645443 ATGGGGTAACAAAAAGAACATGG + Intronic
1033461487 7:141551085-141551107 ATAAATTAACTAAATGAACAAGG - Intergenic
1033702074 7:143849254-143849276 CTATAGTAACCAAATCAACATGG + Intergenic
1033813850 7:145049138-145049160 CTATAGTAACCAAAACAACATGG - Intergenic
1033953097 7:146810230-146810252 CTGTAGTAATCAAAAGAGCATGG - Intronic
1035199376 7:157250628-157250650 AAGTTGTAACCAAATAAATATGG - Intronic
1035830542 8:2690138-2690160 ATTTAGCAAACAAATGACCATGG + Intergenic
1035890991 8:3342616-3342638 ATGAAGAAGCCAAAAGAACAGGG - Intronic
1036558430 8:9881312-9881334 CTACAGTAACCAAAAGAACATGG + Intergenic
1037478560 8:19281690-19281712 ATATAGTAACCAAAACAGCATGG - Intergenic
1038871473 8:31499217-31499239 CTGTAGTAACCAAAACAGCATGG + Intergenic
1038951376 8:32418274-32418296 GTTTAGTAACCAAATTAAAAAGG + Intronic
1039208209 8:35181039-35181061 ATATAGTAACCAAAAGAGCATGG + Intergenic
1039643525 8:39252096-39252118 CTATAGTAACCAAATCACCATGG - Intronic
1039934202 8:42026151-42026173 CTGTAGTAACCAATTCAGCAAGG - Intronic
1040473380 8:47755332-47755354 CTATAGTAACCAAATCAGCATGG - Intergenic
1040628328 8:49178228-49178250 ATATAGTAACCAAAACAGCATGG + Intergenic
1040910282 8:52511222-52511244 CTATAGTAACCAAAAGAGCATGG + Intergenic
1041051244 8:53936855-53936877 TTGTAGTAACCAAAACAGCATGG + Intronic
1041579522 8:59441932-59441954 TTGTAGTAACCAAAACAGCATGG - Intergenic
1041859283 8:62493404-62493426 CTATAGTAACCAAAACAACATGG - Intronic
1041883960 8:62786794-62786816 AAGAAGTAACCAAATCATCAGGG - Intronic
1042002605 8:64142818-64142840 CTATATTAACCAAATCAACATGG + Intergenic
1042233572 8:66585163-66585185 CTGTAGTAACCAAAACAGCATGG + Intronic
1042392080 8:68247609-68247631 CTGTATTAACCAAAAGAGCATGG - Intergenic
1042812459 8:72841283-72841305 CTATAGTAACCAAAAGAGCATGG - Intronic
1042952520 8:74216177-74216199 CTATAGTAACCAAAAGAGCATGG - Intergenic
1043215880 8:77587094-77587116 ATAGATTAACCAAATGCACATGG + Intergenic
1043462003 8:80469529-80469551 ATCTATTAACCAAAGTAACATGG + Intergenic
1043654748 8:82648878-82648900 ATATAGTAACCAAAACAGCATGG + Intergenic
1044175350 8:89113848-89113870 ATATGGTAACCAAAACAACATGG + Intergenic
1044497185 8:92900620-92900642 CTGTAGTAACCAAAACAGCATGG - Intronic
1044559614 8:93600040-93600062 ATGTAGGAACCTAATGTACAGGG - Intergenic
1045143109 8:99309562-99309584 CTATAGTAACCAAAACAACATGG - Intronic
1045347647 8:101308721-101308743 ATGTAATAAACACATGTACATGG - Intergenic
1045817080 8:106289687-106289709 CTATAGTAACCAAAACAACACGG + Intronic
1046216023 8:111148245-111148267 CTGTAGTAACCAAAACAGCATGG - Intergenic
1046655532 8:116890040-116890062 ATGTAGAAAGCAAATGAAGTTGG - Intergenic
1047431201 8:124793948-124793970 CTATAGTAACCAAATCAGCATGG - Intergenic
1047817309 8:128478854-128478876 ATGTGGCAAGCAAATGATCATGG - Intergenic
1047936826 8:129789368-129789390 CTATAGTAACCAAAAGAGCATGG - Intergenic
1048157097 8:131966892-131966914 ATGTATTAAACAAAAGAATATGG - Intronic
1048271848 8:133035580-133035602 ATATATTAAGCAACTGAACAGGG - Intronic
1048521384 8:135158565-135158587 AAGTAGTAACCATAAGAAGAAGG - Intergenic
1048676286 8:136785555-136785577 CTGTAGTAACCAAAACAGCATGG + Intergenic
1048756465 8:137744139-137744161 CTGTAGTAACCAAAACACCATGG - Intergenic
1049136030 8:140901018-140901040 CTATAGTAACCAAATCAGCATGG + Intronic
1050177936 9:2888576-2888598 CTGCAGTAACCAAAGCAACAGGG + Intergenic
1050510696 9:6391999-6392021 CTGTAGTAACCAAAACAGCATGG + Intergenic
1050578235 9:7022035-7022057 CTGTAGTAACCAAAATGACATGG - Intronic
1051004593 9:12328064-12328086 TTATAGTAACCAAAACAACATGG - Intergenic
1051294508 9:15581541-15581563 ATACAGTAACCAAAACAACATGG + Intronic
1051828282 9:21246645-21246667 CTGTAGTAACCAAAGCAGCATGG + Intergenic
1051930981 9:22385322-22385344 ATGTAATATCAAAATGAAAAAGG + Intergenic
1052305369 9:27002669-27002691 CTATAGTAACCAAATCAGCATGG - Intronic
1052531527 9:29691013-29691035 AAATAGTAACCAAATTTACAAGG + Intergenic
1052668418 9:31523768-31523790 ATGCAAAAATCAAATGAACATGG + Intergenic
1052678501 9:31657860-31657882 ATATAGTAACCAAAACAACATGG - Intergenic
1052690054 9:31806365-31806387 CTGTAGTAACCAAAACAGCATGG + Intergenic
1052722521 9:32189614-32189636 CTATAGTAACCAAAACAACATGG + Intergenic
1052734724 9:32329411-32329433 CTATAGTAACCAAATCAGCATGG + Intergenic
1053695091 9:40631248-40631270 CTGTAGTAACCAAAACATCATGG + Intergenic
1053942078 9:43261635-43261657 CTGTAGTAACCAAAACATCATGG + Intergenic
1054269750 9:63008868-63008890 CTGTAGTAACCAAAACATCATGG - Intergenic
1054306335 9:63430473-63430495 CTGTAGTAACCAAAACATCATGG + Intergenic
1054405077 9:64754463-64754485 CTGTAGTAACCAAAACATCATGG + Intergenic
1054438702 9:65239955-65239977 CTGTAGTAACCAAAACATCATGG + Intergenic
1054491702 9:65781991-65782013 CTGTAGTAACCAAAACATCATGG - Intergenic
1055008311 9:71534886-71534908 ATATCCTAACCAAATTAACACGG + Intergenic
1055134483 9:72812217-72812239 ATGGAGTTAGCAAATGAACTGGG + Intronic
1055147731 9:72956635-72956657 ATGTAGTAATCAAAAGCATAGGG - Intronic
1055243391 9:74212015-74212037 CTCTAGTAACCAAAACAACATGG - Intergenic
1055278194 9:74643191-74643213 GTGGAATAACCAAACGAACAGGG + Intronic
1056087822 9:83170306-83170328 CTGTAGTAACCAAAACAGCATGG - Intergenic
1056258080 9:84820504-84820526 ATGTATTAACCAACTGTTCACGG - Intronic
1057155283 9:92832639-92832661 CTGTAGTAACCAAAATAGCATGG + Intergenic
1057343138 9:94221495-94221517 CTATAGTAACCAAAAGAGCATGG + Intergenic
1057370735 9:94470619-94470641 CTATAGTAACCAAAAGAGCATGG - Intergenic
1057451038 9:95160408-95160430 CTGTAGTAACCAAAACAGCATGG - Intronic
1058236075 9:102491586-102491608 CTGTAGTAACCAAACCAGCATGG + Intergenic
1058248721 9:102664433-102664455 CTATAGTAACCAAAAGAGCATGG - Intergenic
1058406380 9:104679987-104680009 CTGTAGTAACCAAAACAGCATGG + Intergenic
1058413497 9:104761492-104761514 CTATAGTAACCAAAACAACATGG + Intergenic
1059053088 9:110949613-110949635 ATGGGGTAACCAAATAAACTGGG - Intronic
1059833441 9:118124552-118124574 ATATAGTAACCAAAACAGCATGG - Intergenic
1060079683 9:120631356-120631378 CTTTAGTAACCAAAACAACATGG - Intronic
1060082687 9:120665976-120665998 CTATAGTAACCAAAACAACATGG - Intronic
1060320007 9:122549741-122549763 TTATAGTAACCAAAACAACATGG - Intergenic
1060766907 9:126301047-126301069 ATGTGGTGACCAGAAGAACAGGG + Intergenic
1061981445 9:134106373-134106395 CTATAGTAACCAAAATAACAGGG + Intergenic
1202777535 9_KI270717v1_random:4866-4888 CTGTAGTAACCAAAACATCATGG + Intergenic
1186361643 X:8848568-8848590 ATGCTGTAACAGAATGAACAGGG - Intergenic
1186381509 X:9065197-9065219 CTGTAGTAAGCAAAACAACATGG + Intronic
1187214205 X:17260126-17260148 CTATAGTAACCAAAACAACATGG + Intergenic
1187609295 X:20923375-20923397 ATGTAGTTACCAAAACAACATGG - Intergenic
1187636079 X:21229828-21229850 CTGTAGTAACCAAAACAGCATGG - Intergenic
1187782292 X:22841011-22841033 CTATAGTAACCAAAACAACATGG + Intergenic
1187785743 X:22884038-22884060 AAGAAGTAATCAAATGGACATGG + Intergenic
1187787472 X:22908233-22908255 ATATAGTAACCAAAACAGCATGG - Intergenic
1187846687 X:23545729-23545751 CTGTAGTAACCAAAAGAGCATGG + Intergenic
1188118438 X:26275082-26275104 ATATAGTAACCAAAATAACATGG - Intergenic
1188339080 X:28976955-28976977 ATCAGGTAAGCAAATGAACATGG + Intronic
1188381695 X:29501692-29501714 ACATAGTAACCAAATCAGCATGG - Intronic
1188447390 X:30270081-30270103 ATGTATTAAATAAATGAAAATGG - Intergenic
1188644764 X:32552235-32552257 ATATAGTAACCAAAACAGCATGG + Intronic
1188796797 X:34476916-34476938 CTATAGTAACCAAAACAACATGG - Intergenic
1188814903 X:34700909-34700931 CTGTAGTAACCAAAACAGCATGG + Intergenic
1188853836 X:35166960-35166982 CTATAGTAACCAAATCAGCATGG - Intergenic
1188957557 X:36451474-36451496 ATATAGTAACCAAAACAGCATGG + Intergenic
1188957598 X:36452024-36452046 ATGTAATAACCTAATAAAAATGG + Intergenic
1188972509 X:36634902-36634924 CTGTAGGAAACAAAAGAACATGG - Intergenic
1190513640 X:51200190-51200212 CTGTAATAACCAAATTAGCATGG + Intergenic
1190532222 X:51390830-51390852 ATATAGTAGCCAAAAGAGCATGG + Intergenic
1190973262 X:55373543-55373565 ATATAGTAAACAAATAAGCATGG - Intergenic
1191030976 X:55971173-55971195 CTGTAGTAAGCAAAACAACATGG + Intergenic
1191051994 X:56203804-56203826 ATATAGTAACCAAAACAGCATGG - Intergenic
1191176922 X:57513979-57514001 CTGGAGAAACCAGATGAACAAGG - Intergenic
1191217046 X:57943668-57943690 ATGTAGTAATCAAAACAGCATGG - Intergenic
1191725947 X:64281311-64281333 ATATAGTAACCAAAACAGCATGG + Intronic
1191764469 X:64682266-64682288 ATGTGGTAACTAATTGAAGATGG + Intergenic
1191818915 X:65281129-65281151 CTGTAATAACCAAAACAACATGG + Intergenic
1191972870 X:66837471-66837493 CTCTAGTAACCAAAAGAGCATGG + Intergenic
1192291353 X:69798960-69798982 CTATAGTAACCAAAACAACATGG + Intronic
1192596769 X:72417829-72417851 ATATAGTAACCAAAACAGCATGG + Intronic
1192855577 X:75007004-75007026 ATATGGTAACCAAAAGAGCATGG - Intergenic
1192985324 X:76392956-76392978 CTGCAGTAACCAAAACAACATGG - Intergenic
1192989810 X:76438372-76438394 CTATAGTAACCAAATCAGCATGG - Intergenic
1193022675 X:76807756-76807778 CTATAGTAACCAAAACAACATGG + Intergenic
1193169600 X:78320491-78320513 CTATAGTAACCAAAACAACATGG - Intronic
1193175968 X:78393427-78393449 ATGTAGTAACCAAAACAGCATGG + Intergenic
1193230976 X:79046066-79046088 ATGTAGTCACCAAAACAGCATGG + Intergenic
1193263831 X:79443548-79443570 ATATAGTAACCAAAATAACATGG - Intergenic
1193301603 X:79895470-79895492 CTGCAGTAACCAAATTAGCATGG + Intergenic
1193390654 X:80924199-80924221 CTATAGTAACCAAAACAACATGG - Intergenic
1193456267 X:81734758-81734780 CTGTATTAACCAACAGAACATGG + Intergenic
1193496935 X:82225880-82225902 CTATAGTAACCAAAAGAGCATGG - Intergenic
1193523709 X:82562634-82562656 CTGTAGTAACCAAAAAAGCATGG + Intergenic
1193876430 X:86867961-86867983 ATGCAGAAACCAAATGTATATGG - Intergenic
1194099023 X:89678941-89678963 CTGCAGTAACCAAAACAACATGG + Intergenic
1194317770 X:92402395-92402417 ATCCAGTAACCAAAACAACATGG + Intronic
1194491987 X:94562031-94562053 CTCTGGTAACCAAAAGAACACGG - Intergenic
1194563463 X:95451325-95451347 CTATAGTAACCAAAAGAGCACGG - Intergenic
1194708568 X:97204933-97204955 CTGTAGTAACCAAAACAGCATGG + Intronic
1194876642 X:99197741-99197763 ATGTAGGAGGCAAATGAAAATGG - Intergenic
1195140542 X:101954943-101954965 CTATAGTAACCAAAACAACATGG + Intergenic
1195168376 X:102242427-102242449 CTATAGTAACCAAATCAGCAAGG - Intergenic
1195190481 X:102444660-102444682 CTATAGTAACCAAATCAGCAAGG + Intronic
1195632488 X:107072752-107072774 CTGTAGTAACCAAAACAGCATGG + Intronic
1195976084 X:110528606-110528628 CTGTAGTAACCAAAACAGCATGG + Intergenic
1195982881 X:110598945-110598967 CTGTAATAACCAAAACAACATGG - Intergenic
1196140842 X:112261803-112261825 CTGCAGTAACCAAAACAACATGG + Intergenic
1196260237 X:113570595-113570617 CTGTAGTAACCAAAACAGCATGG - Intergenic
1196509132 X:116485081-116485103 CTGTAGTAACCAAAACAGCATGG + Intergenic
1196598879 X:117578061-117578083 CTGTAGTAACCAAAACAGCAAGG - Intergenic
1196993938 X:121359999-121360021 ATACAGTAACCAAATCAGCATGG + Intergenic
1197466453 X:126809598-126809620 TTATAGTAACCAAAACAACATGG - Intergenic
1197484207 X:127027308-127027330 GTATAGTAACCAAAACAACAAGG + Intergenic
1197497515 X:127203300-127203322 CTGTAGTAACCAAAACAGCATGG + Intergenic
1197508377 X:127337780-127337802 ATATAGTAACCAAAACAGCATGG - Intergenic
1197549253 X:127867682-127867704 CTATAGTAACCAAAAGAACATGG + Intergenic
1197901106 X:131373187-131373209 GAGTAGTTACCAAATAAACAAGG + Intronic
1197986861 X:132275580-132275602 CTATAGTAACCAAAACAACATGG - Intergenic
1197988358 X:132291034-132291056 CTATAGTAACCAAAAGAGCATGG - Intergenic
1198514798 X:137395192-137395214 CTATAGTAACCAAAACAACATGG - Intergenic
1199140707 X:144308346-144308368 GTGTAGAAACCAAATAAACTAGG + Intergenic
1199196053 X:145032289-145032311 CTGTAGTAATCAAATCTACATGG - Intergenic
1199397471 X:147356235-147356257 CTATGGTAACCAAAAGAACATGG + Intergenic
1199439575 X:147853603-147853625 GTATAGTAACCAAAATAACATGG - Intergenic
1199441431 X:147872640-147872662 CTGTAGTAACCAAAACAGCATGG + Intergenic
1199507660 X:148584429-148584451 ATGTAGTAATTAAATAATCAAGG + Intronic
1199821084 X:151447364-151447386 ATATAGTAAACAAAACAACATGG + Intergenic
1199917336 X:152357932-152357954 CTGTAGTAACCAAAACAGCATGG - Intronic
1200295166 X:154912581-154912603 CTGTAGTAACCAAAACAGCATGG - Intronic
1200307252 X:155039722-155039744 CTATAGTAACCAAAACAACATGG - Intronic
1200328825 X:155272739-155272761 CTATAGTAACCAAAATAACAAGG - Intergenic
1200379907 X:155824854-155824876 ATTTAGTTACCAAAACAACATGG + Intergenic
1200452042 Y:3340320-3340342 CTGCAGTAACCAAAACAACATGG + Intergenic
1200548609 Y:4550564-4550586 ATGAAATAAAAAAATGAACAAGG - Intergenic
1200625944 Y:5515682-5515704 ATCCAGTAACCAAAACAACATGG + Intronic
1200646364 Y:5789090-5789112 CTGCAGTAACCAAAAGAGCATGG + Intergenic
1200946346 Y:8843884-8843906 ATATAGTAACCAAAACAACATGG + Intergenic
1201192878 Y:11463153-11463175 CTGTAGTAACCAAAACATCATGG + Intergenic
1201367233 Y:13221051-13221073 ATATAGTAACCAAAACAGCATGG - Intergenic
1202026819 Y:20532944-20532966 CTATAGTAACCAAAACAACATGG + Intergenic