ID: 1062785715

View in Genome Browser
Species Human (GRCh38)
Location 10:263106-263128
Sequence CGGTGCTGCAGCTGAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062785707_1062785715 19 Left 1062785707 10:263064-263086 CCCATCACTGAGACAAGTATGGC No data
Right 1062785715 10:263106-263128 CGGTGCTGCAGCTGAGGAGATGG No data
1062785712_1062785715 -3 Left 1062785712 10:263086-263108 CCAGGGAAGAAGGCTTTAATCGG 0: 10
1: 96
2: 258
3: 231
4: 235
Right 1062785715 10:263106-263128 CGGTGCTGCAGCTGAGGAGATGG No data
1062785708_1062785715 18 Left 1062785708 10:263065-263087 CCATCACTGAGACAAGTATGGCC No data
Right 1062785715 10:263106-263128 CGGTGCTGCAGCTGAGGAGATGG No data
1062785704_1062785715 28 Left 1062785704 10:263055-263077 CCCACAAAGCCCATCACTGAGAC No data
Right 1062785715 10:263106-263128 CGGTGCTGCAGCTGAGGAGATGG No data
1062785705_1062785715 27 Left 1062785705 10:263056-263078 CCACAAAGCCCATCACTGAGACA No data
Right 1062785715 10:263106-263128 CGGTGCTGCAGCTGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062785715 Original CRISPR CGGTGCTGCAGCTGAGGAGA TGG Intergenic
No off target data available for this crispr