ID: 1062786478

View in Genome Browser
Species Human (GRCh38)
Location 10:269520-269542
Sequence GCTGCTAGTGGGCATGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062786478_1062786483 -4 Left 1062786478 10:269520-269542 CCTGCAACATGCCCACTAGCAGC No data
Right 1062786483 10:269539-269561 CAGCTGGGAACCCCTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062786478 Original CRISPR GCTGCTAGTGGGCATGTTGC AGG (reversed) Intergenic
No off target data available for this crispr