ID: 1062790227

View in Genome Browser
Species Human (GRCh38)
Location 10:299132-299154
Sequence GTGTGCACATTGTGTAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062790227_1062790229 2 Left 1062790227 10:299132-299154 CCCATCTTACACAATGTGCACAC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1062790229 10:299157-299179 AGTTTTTTCTGAACCATTTGAGG No data
1062790227_1062790231 22 Left 1062790227 10:299132-299154 CCCATCTTACACAATGTGCACAC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1062790231 10:299177-299199 AGGATAAGTTAAATACATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062790227 Original CRISPR GTGTGCACATTGTGTAAGAT GGG (reversed) Intronic
904028961 1:27522052-27522074 GTGTGCACATGGTAGCAGATGGG + Intergenic
904881337 1:33699514-33699536 ATGTGAAAATTGTGTAAGTTTGG - Intronic
904994228 1:34618438-34618460 GTTTCCACATTGTGTATGAAGGG - Intergenic
906869673 1:49464333-49464355 ATGTGAACATAGTGTAACATTGG - Intronic
907732143 1:57077045-57077067 GTGTGCCCAGTGTGTCACATAGG + Intronic
916454131 1:164953118-164953140 CTGTGCACCCTGTGGAAGATAGG + Intergenic
920932796 1:210404629-210404651 ATGGGCCCATTGTGTAAGACTGG - Exonic
921223397 1:212991988-212992010 GTCTGCAGATTGTGAAAGAAGGG - Intronic
922557715 1:226545730-226545752 TTGTTCACAGTGTGGAAGATGGG - Intergenic
924614869 1:245604344-245604366 GTGTGCCCACGGTGTAATATAGG - Intronic
1062790227 10:299132-299154 GTGTGCACATTGTGTAAGATGGG - Intronic
1063144895 10:3288190-3288212 GTCTGCACACTGCGTAAGTTTGG - Intergenic
1065513898 10:26506158-26506180 GTGTGCATGTGGTGTTAGATAGG - Intronic
1066590639 10:36989894-36989916 ATGTGGACATAGTTTAAGATGGG + Intergenic
1068527341 10:58145107-58145129 ATGTGCACATAGGGAAAGATGGG - Intergenic
1070116463 10:73533587-73533609 GTGAGCTCATTGTTTGAGATTGG - Intronic
1070642955 10:78182171-78182193 ATGGGCACATTGTGTAAAATGGG + Intergenic
1073114752 10:101085464-101085486 TTGTGGACATGGTGTAGGATGGG + Intergenic
1081670909 11:44942154-44942176 GTGTGTGCATTGTGTATGGTGGG - Intronic
1083144321 11:60747382-60747404 GTGTGCACATGGAGTGATATTGG - Intergenic
1083266922 11:61551066-61551088 GTGGGCACAGTGTGTGTGATAGG + Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1085965920 11:81526290-81526312 TTTTGTACATTGTGTAAGAAAGG + Intergenic
1086452576 11:86931847-86931869 GAGTGGACATTGAGGAAGATAGG + Intronic
1086863283 11:91950015-91950037 GTTTTCACATTGTGGAGGATGGG + Intergenic
1087936588 11:104040755-104040777 GTGTGTATAGTGTGTAAAATTGG - Intronic
1089608228 11:119654390-119654412 CTGTGCCCACTGTGTAAGAGGGG + Intronic
1089841709 11:121424514-121424536 GTGTGCAAATTGGGTAGGAATGG - Intergenic
1091828134 12:3530654-3530676 GAGTGCACAATGTGTAAGGGAGG + Intronic
1093386036 12:18555574-18555596 GTATACACATTTTTTAAGATAGG + Intronic
1093674615 12:21923109-21923131 TTGTGTATATGGTGTAAGATAGG - Intronic
1093815944 12:23546699-23546721 CTGTGCACATTTTGTAATTTGGG - Intronic
1096962684 12:55595905-55595927 ATGTGCACATTGTGCAGGTTAGG - Intergenic
1098479835 12:70944897-70944919 GTGTGCACCTTCTGTAATATTGG + Intergenic
1099359994 12:81688486-81688508 GTTTGCATTTTGTGTCAGATAGG - Intronic
1104327766 12:127816325-127816347 GTGTTCTCAATGTGCAAGATTGG + Intergenic
1104698708 12:130884532-130884554 TTTTGCATATAGTGTAAGATAGG + Intergenic
1105359162 13:19691200-19691222 GTGTGAACATTGATAAAGATGGG + Intronic
1107222756 13:38005159-38005181 GTATGCACATTTTCTAAAATTGG - Intergenic
1107620264 13:42220980-42221002 GTATGCATATTGTGTAGGTTGGG + Intronic
1109354125 13:61218458-61218480 GTGTACACATTCTGTGATATTGG - Intergenic
1111363904 13:87214990-87215012 ATGTGCACATTTTTTTAGATTGG - Intergenic
1114005142 14:18304511-18304533 GTATACAAATTGTGTAATATAGG - Intergenic
1116519111 14:45829495-45829517 GGGTGCACATTCTGCAATATTGG - Intergenic
1118490361 14:66253238-66253260 GTCTACACATTGTGTATGGTCGG + Intergenic
1121234332 14:92380979-92381001 GTGTGCACATAGTGAGAGGTGGG + Intronic
1123389598 15:19856744-19856766 GTATACAAATTGTGTAATATAGG - Intergenic
1125452456 15:39823605-39823627 GTGTGGAGAATGTGTTAGATGGG - Intronic
1125753668 15:42047645-42047667 GTGTGCACACTGGGTAACAGTGG - Intronic
1131440867 15:92458683-92458705 GTGTGCACAATGCATAAGACTGG + Intronic
1135916938 16:26613742-26613764 GTGTGCACAGGGTGTGAGAGGGG - Intergenic
1143355464 17:6324757-6324779 GTGTGCACATGGAGTGTGATTGG - Intergenic
1146393273 17:32442481-32442503 GTGTGCACATTCATGAAGATGGG - Intergenic
1150520347 17:65860710-65860732 TTTTGTCCATTGTGTAAGATAGG - Intronic
1153377480 18:4396858-4396880 TTGTGCACATTATGCAATATGGG - Intronic
1154532282 18:15359350-15359372 GTATACAAATTGTGTAATATAGG + Intergenic
1154956185 18:21257843-21257865 ATGTGCACAATGTGTGAGGTGGG - Intronic
1157597093 18:48870561-48870583 GTGTGTACATGGTGTGAGAATGG + Intergenic
1157600962 18:48893094-48893116 GTGTGAGCATTGTGTATGTTTGG + Intergenic
1157614632 18:48979216-48979238 GTGTGTACATGGTGTGAGAATGG - Intergenic
1159555053 18:69937074-69937096 GTGTGCAAATACCGTAAGATAGG + Intronic
1160429133 18:78799657-78799679 GTGTGCGCATTGTGTGTGGTGGG - Intergenic
1161983076 19:7640631-7640653 GTTTGCACATGGTGGCAGATGGG + Intronic
1166985912 19:46660085-46660107 GTGTTCTCATGGTGGAAGATGGG - Intronic
925096608 2:1209233-1209255 GTGTGACCATTGTCTGAGATGGG + Intronic
938399467 2:130976823-130976845 GTGTGTGCATTGTGTATGTTTGG + Intronic
938531379 2:132190578-132190600 GTATACAAATTGTGTAATATAGG + Intronic
938655502 2:133428450-133428472 TTTTGCACATTGTGTAAAATAGG - Intronic
938747149 2:134290163-134290185 GTGTGCACTTTTGGAAAGATGGG - Intronic
943912630 2:193588161-193588183 GTTTGTATATGGTGTAAGATAGG - Intergenic
946227832 2:218273800-218273822 GTTTCCTCATTTTGTAAGATGGG + Intronic
946912084 2:224473833-224473855 CTTTGCGCATTGTGTAAGTTGGG - Exonic
947059531 2:226147260-226147282 GTTTGTACATGGTGTGAGATAGG - Intergenic
948510777 2:238463468-238463490 GTGTACATATGGTGTAAGGTAGG + Intergenic
1169544461 20:6636538-6636560 GTGTGCACGTTGTGTCTTATTGG - Intergenic
1169974499 20:11308576-11308598 TTGTGCATATAGTGTAAGATAGG - Intergenic
1170386582 20:15825066-15825088 GTGAGAACATTGTCAAAGATTGG - Intronic
1174967182 20:55230248-55230270 TTGTGTACACTGTGTAAGCTGGG - Intergenic
1175493765 20:59397946-59397968 GTGTGCACCATGTGTAAGAATGG - Intergenic
1176765080 21:13008851-13008873 GTATACAAATTGTGTAATATAGG - Intergenic
1177480387 21:21678931-21678953 GTTTGTATATTGTGTAAGGTAGG + Intergenic
1178068285 21:28932033-28932055 GTGTGCACATTGTGTATCTCAGG - Intronic
1178289388 21:31354064-31354086 GTGGGCAGATTGTGTGAGGTCGG - Intronic
1180429654 22:15235303-15235325 GTATACAAATTGTGTAATATAGG - Intergenic
1180512265 22:16103642-16103664 GTATACAAATTGTGTAATATAGG - Intergenic
1182462645 22:30493396-30493418 GTTTTCCCATTATGTAAGATGGG - Intronic
1182528443 22:30936909-30936931 GTGAGCACATTGTCTAACAAGGG - Intronic
951825196 3:26860452-26860474 GTGTACACATTGTGTATGGCAGG - Intergenic
952986243 3:38786879-38786901 GTGTGCCATTGGTGTAAGATTGG - Intronic
956398422 3:68850285-68850307 GTGTGTACATTGTGGATGCTTGG - Intronic
957193985 3:77044268-77044290 GTAAGCACATTGTATAAGTTGGG + Intronic
963416244 3:144999651-144999673 GTCTGCACATTGTGTGAGCATGG + Intergenic
966030862 3:175346410-175346432 GTGCGCTCATTGAGGAAGATGGG - Intronic
966198085 3:177333758-177333780 TTGTCCACTTTGTGTATGATTGG - Intergenic
969786076 4:9457859-9457881 GTGTACACCTTCTGTAATATTGG + Intergenic
971695227 4:29893448-29893470 GTGTGTACATTGTGTACGACAGG - Intergenic
975362410 4:73486324-73486346 GTGTGTACATGGTGTTAAATTGG + Intronic
979519724 4:121652495-121652517 GATTGCACAATGTGTAAAATTGG + Intergenic
980994259 4:139765255-139765277 GTATGCACATTGTCTAAAACTGG + Intronic
983623421 4:169783047-169783069 GTGTGCACATTCTGTGATATGGG - Intergenic
987129092 5:14843860-14843882 GTGTGCCCACTGTGTATGAATGG - Intronic
987303206 5:16616050-16616072 GTGTGCACAGTGTGGAAAACAGG - Intronic
987990654 5:25207292-25207314 ATGTGCACATTGTGCAGGTTAGG + Intergenic
988012548 5:25508119-25508141 ATGTGCACATTGTGCAGGTTAGG - Intergenic
989200939 5:38763132-38763154 GTGTACATATTGTTTAAAATCGG + Intergenic
990023152 5:51153561-51153583 GTTTGTATATTGTGAAAGATAGG - Intergenic
991219107 5:64191961-64191983 TTTTGCATATGGTGTAAGATAGG + Intronic
992080168 5:73229233-73229255 GTGTCCACATTGTGAAACAAAGG - Intergenic
994396014 5:99226339-99226361 GTGTGAACCTTCTGTAATATTGG + Intergenic
995630223 5:114124801-114124823 CTGTCCACATTATGTAAAATTGG + Intergenic
1002292511 5:178209544-178209566 GTGGGCAGATTGTGTGAGGTTGG + Intronic
1003857517 6:10291473-10291495 GTATGAAAATTGTGTAAGGTAGG + Intergenic
1005907021 6:30271085-30271107 TTTTGCATATGGTGTAAGATCGG - Intergenic
1009048094 6:58251603-58251625 GTGTACACCTTCTGTAATATTGG - Intergenic
1009223978 6:61006384-61006406 GTGTACACCTTCTGTAATATTGG - Intergenic
1012978875 6:105809288-105809310 TTATGCACATTTTGTAAGACAGG - Intergenic
1024506301 7:50165069-50165091 GGGTGCACATTGTGGAAGGTTGG + Intergenic
1034230243 7:149519801-149519823 TTTTGCACATGGTGAAAGATGGG - Intergenic
1035688441 8:1543360-1543382 TTTTGCAGATTTTGTAAGATGGG + Intronic
1038489628 8:27960948-27960970 GTGAGCAAATTGGGCAAGATTGG - Intronic
1040559747 8:48514125-48514147 GTGTGCACACTGTGTGAGCGAGG + Intergenic
1042982621 8:74547530-74547552 GTGTGCACATTGTGGATGTGTGG + Intergenic
1043321690 8:78994629-78994651 TTTTGCACATAGTGAAAGATGGG + Intergenic
1044778775 8:95722237-95722259 CTGTGGTCATTGTGTATGATAGG - Intergenic
1050045200 9:1536232-1536254 TTGTGTATATTGTGTGAGATAGG + Intergenic
1053709989 9:40797075-40797097 GTATACAAATTGTGTAATATAGG + Intergenic
1054419894 9:64917869-64917891 GTATACAAATTGTGTAATATAGG + Intergenic
1056099705 9:83289394-83289416 GTGTGCAAAGTATGAAAGATGGG - Intronic
1057214265 9:93219352-93219374 GTGTGCACTTTTTGAAAGAGAGG - Intronic
1191961197 X:66704019-66704041 GTTTGCATATGGTGAAAGATAGG - Intergenic
1194619475 X:96151579-96151601 ATGTGCACATTGTGCAGGTTAGG - Intergenic
1194657553 X:96591597-96591619 GAAAGCACATTGTGTAAGCTTGG + Intergenic
1195819940 X:108933741-108933763 ATGTGCACAATGTGCAGGATAGG + Intergenic
1198860814 X:141068067-141068089 GTGTGGTCATTGGGTCAGATTGG - Intergenic
1198901878 X:141519319-141519341 GTGTGGTCATTGGGTCAGATTGG + Intergenic
1199051180 X:143238823-143238845 GTGTGCACATTGTGAGAGGAGGG - Intergenic