ID: 1062791270

View in Genome Browser
Species Human (GRCh38)
Location 10:307946-307968
Sequence CTCCAGATGGACCGTGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062791270_1062791283 7 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791283 10:307976-307998 GGGAGGCTTTGGGGGTGCCTGGG No data
1062791270_1062791288 24 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791288 10:307993-308015 CCTGGGCGGGGCCCAGCACATGG No data
1062791270_1062791277 -10 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791277 10:307959-307981 CCATCTGGAGGGCAGCAGGGAGG No data
1062791270_1062791285 11 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791285 10:307980-308002 GGCTTTGGGGGTGCCTGGGCGGG No data
1062791270_1062791284 10 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791284 10:307979-308001 AGGCTTTGGGGGTGCCTGGGCGG No data
1062791270_1062791286 12 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791286 10:307981-308003 GCTTTGGGGGTGCCTGGGCGGGG No data
1062791270_1062791282 6 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791282 10:307975-307997 AGGGAGGCTTTGGGGGTGCCTGG No data
1062791270_1062791279 -3 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791279 10:307966-307988 GAGGGCAGCAGGGAGGCTTTGGG No data
1062791270_1062791280 -2 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791280 10:307967-307989 AGGGCAGCAGGGAGGCTTTGGGG No data
1062791270_1062791278 -4 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791278 10:307965-307987 GGAGGGCAGCAGGGAGGCTTTGG No data
1062791270_1062791281 -1 Left 1062791270 10:307946-307968 CCCGGCACACGGTCCATCTGGAG No data
Right 1062791281 10:307968-307990 GGGCAGCAGGGAGGCTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062791270 Original CRISPR CTCCAGATGGACCGTGTGCC GGG (reversed) Intronic
No off target data available for this crispr