ID: 1062791290

View in Genome Browser
Species Human (GRCh38)
Location 10:308004-308026
Sequence CTCCAGATGGACCATGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 2, 2: 1, 3: 19, 4: 184}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062791290_1062791301 -1 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791301 10:308026-308048 GGGCAGCAGGGAGGGTTCAGGGG No data
1062791290_1062791308 24 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791308 10:308051-308073 CCTGGGCGGGGCCCAGCACACGG No data
1062791290_1062791304 10 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791304 10:308037-308059 AGGGTTCAGGGGTGCCTGGGCGG No data
1062791290_1062791299 -3 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791299 10:308024-308046 GAGGGCAGCAGGGAGGGTTCAGG No data
1062791290_1062791298 -9 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791298 10:308018-308040 CATCTGGAGGGCAGCAGGGAGGG No data
1062791290_1062791306 12 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791306 10:308039-308061 GGTTCAGGGGTGCCTGGGCGGGG No data
1062791290_1062791302 6 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791302 10:308033-308055 AGGGAGGGTTCAGGGGTGCCTGG No data
1062791290_1062791305 11 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791305 10:308038-308060 GGGTTCAGGGGTGCCTGGGCGGG No data
1062791290_1062791300 -2 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791300 10:308025-308047 AGGGCAGCAGGGAGGGTTCAGGG No data
1062791290_1062791297 -10 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791297 10:308017-308039 CCATCTGGAGGGCAGCAGGGAGG No data
1062791290_1062791303 7 Left 1062791290 10:308004-308026 CCCAGCACATGGTCCATCTGGAG 0: 1
1: 2
2: 1
3: 19
4: 184
Right 1062791303 10:308034-308056 GGGAGGGTTCAGGGGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062791290 Original CRISPR CTCCAGATGGACCATGTGCT GGG (reversed) Intronic
900160436 1:1220713-1220735 GTCCAGGTGGGCCATGTCCTGGG + Intronic
903695830 1:25206158-25206180 CACCAGATGTCCCATGTGCCGGG - Intergenic
910279815 1:85486998-85487020 CTACAGAAGGACAATGTTCTGGG + Intronic
910428943 1:87142177-87142199 ATCCCGGTGGACCATGTCCTGGG + Intronic
910845805 1:91603801-91603823 CTGCAAAAGGACCATGTGCTTGG - Intergenic
911566852 1:99472422-99472444 TTCCAGGTGGAGGATGTGCTTGG + Intergenic
916883607 1:169046152-169046174 ATGCAGAAGGACCATGTGGTGGG - Intergenic
921828931 1:219705273-219705295 CTGCTCATTGACCATGTGCTTGG + Intronic
1062791227 10:307830-307852 CTCCAGATGGACTGTGTGCCGGG - Intronic
1062791248 10:307888-307910 CTCCAGAGGGACCGTGTGCCGGG - Intronic
1062791270 10:307946-307968 CTCCAGATGGACCGTGTGCCGGG - Intronic
1062791290 10:308004-308026 CTCCAGATGGACCATGTGCTGGG - Intronic
1062791310 10:308062-308084 CTCCAGATGGACCGTGTGCTGGG - Intronic
1064301789 10:14129550-14129572 CTCCAGGTGGCTCATCTGCTGGG + Intronic
1065047526 10:21757702-21757724 CCCCAGAAGGACAGTGTGCTCGG + Intronic
1065723953 10:28652565-28652587 TTCCAAATAGACCATTTGCTTGG + Intergenic
1065917710 10:30366574-30366596 CTGCAGCTGGTCCATGAGCTGGG + Intronic
1074212473 10:111349534-111349556 CTGCAGATGGACCAAGTCCTCGG - Intergenic
1075999249 10:126902628-126902650 CTCCAGGTGGACCACGGGCCAGG - Intergenic
1076589693 10:131574627-131574649 CTCCAGAGGGCACATCTGCTGGG + Intergenic
1076739552 10:132476576-132476598 CTCCAGCTGGACTGTGTCCTGGG + Intergenic
1078347593 11:10564527-10564549 TTCCACAAGGACCATCTGCTGGG + Intronic
1079681640 11:23304447-23304469 TTGCAGATGGGCCATGTGATAGG + Intergenic
1081616669 11:44595260-44595282 ATCCGGATGGCCCATCTGCTGGG - Intronic
1081982991 11:47281600-47281622 CTCCAGATTGAGGATGGGCTGGG - Exonic
1084264257 11:67996853-67996875 CTTCAGATGCACCACGTGCCTGG + Intronic
1084398469 11:68930089-68930111 CTCCAGATGAACCCTCTGCATGG + Intronic
1085770595 11:79322154-79322176 GTCCAGATGGCCCCTCTGCTGGG + Intronic
1086363871 11:86088397-86088419 CTCCAGGGGGACCTTGTCCTAGG - Intergenic
1089022951 11:115236596-115236618 CTCCGAATACACCATGTGCTTGG - Intronic
1095118012 12:38379542-38379564 CCCAAGATAGACCATGTGATAGG - Intergenic
1096227148 12:49873405-49873427 CTGCAGAAGGAAAATGTGCTTGG - Intronic
1096503878 12:52081059-52081081 CTCCAGATGGCTCCTGTCCTTGG - Intergenic
1097448391 12:59704839-59704861 CTCCAGATGGAGGATGGGGTTGG + Exonic
1098851412 12:75600649-75600671 CACCTGATGAAACATGTGCTGGG + Intergenic
1099768655 12:87023518-87023540 TTCAAGATTGACCATATGCTTGG + Intergenic
1101405103 12:104421635-104421657 CTCGAGATGGTGCATGTGCCTGG + Intergenic
1101583205 12:106062283-106062305 GTCCAAATTGACCAGGTGCTGGG - Intergenic
1102472503 12:113167650-113167672 CTCCAGATTAAGCAGGTGCTGGG + Intronic
1102730229 12:115102674-115102696 CTCCAGATGGACCGTGGGTGTGG + Intergenic
1106504358 13:30357990-30358012 AACCAGGTGGACCCTGTGCTAGG + Intergenic
1107103738 13:36622040-36622062 CACCAGATGGAACATATTCTGGG + Intergenic
1107436919 13:40388530-40388552 CTCAAGATGGACACTGTGCTGGG - Intergenic
1107869641 13:44734997-44735019 CTCCACATGGACCATCTTCTGGG - Intergenic
1107882237 13:44842986-44843008 CTCCAGGTGGACCATGCCTTTGG - Intergenic
1108298503 13:49050556-49050578 TTCAAGATGGACCATATGATAGG - Intronic
1112140754 13:96638975-96638997 CTCCATATAGACCATATGTTAGG - Intronic
1113302719 13:109039424-109039446 GTCCAGATGGACTATCTGCTCGG + Intronic
1116433238 14:44870117-44870139 ATCCAGCTGTACCAGGTGCTGGG + Intergenic
1116513570 14:45778661-45778683 CTCCAGATGGACCATATGCTAGG - Intergenic
1117291046 14:54333113-54333135 CTCAAAATGCACAATGTGCTTGG + Intergenic
1117293195 14:54353517-54353539 CTCCAGAGCCAGCATGTGCTGGG + Intergenic
1118603809 14:67488625-67488647 CACCACAAGGACCATGTGCCTGG + Intronic
1119519265 14:75273745-75273767 CTCCAGATGGAGCATGTCTCAGG + Intergenic
1122371975 14:101233973-101233995 CTGCAGATGTACCCTCTGCTGGG + Intergenic
1124588688 15:31034575-31034597 CTTCAGGTGGACCCTGTCCTTGG - Intronic
1127375474 15:58380754-58380776 CTCCAGCTGGTTCCTGTGCTTGG + Intronic
1128219790 15:65960715-65960737 CTCCAGCGTGACCATTTGCTAGG - Intronic
1128520872 15:68374144-68374166 CCCCAGGTGGAGCATGAGCTAGG - Intronic
1129475948 15:75784829-75784851 CTACAGCTGGTCCATGAGCTGGG - Intergenic
1131282550 15:91033134-91033156 CTGCAGCTGGTCCATGAGCTGGG + Intergenic
1134956998 16:18386765-18386787 CTGCAGCTGTACCATGTGGTTGG + Intergenic
1135194910 16:20386410-20386432 CTCCAGATGGACCACGGGGGTGG - Intronic
1137403335 16:48171121-48171143 CTGCAGAAGGAACAGGTGCTGGG - Intronic
1138901993 16:61283665-61283687 CTCCAGACAGACCATCTGCTAGG - Intergenic
1139796370 16:69486247-69486269 CTCCATTTGGTCCAGGTGCTGGG + Intergenic
1140339382 16:74141920-74141942 CTACAGAAGGAGCATGTGGTGGG + Intergenic
1140895130 16:79317849-79317871 CTCCAAATGGAGCAGGGGCTGGG - Intergenic
1141484558 16:84330184-84330206 ATCCAGAAGGACCCTATGCTTGG + Intergenic
1141596689 16:85101212-85101234 ACCCAGAAGGACCCTGTGCTTGG + Intronic
1142189829 16:88712712-88712734 CTCCAGCAGCAGCATGTGCTGGG + Exonic
1142282508 16:89156071-89156093 CTCCAGCTGGTCCCTGTGCCAGG + Intergenic
1143653514 17:8279158-8279180 CTCCATAAGGACCCTGTGCCTGG - Intergenic
1147540708 17:41356436-41356458 TTCCAGAAGCACCATGTGCTGGG + Intergenic
1152314454 17:79572215-79572237 CACCAAATGGACCATGGTCTGGG - Intergenic
1155105324 18:22659256-22659278 CTCCAAATAAACCATGTGCTTGG + Intergenic
1155112372 18:22728532-22728554 CTTCAGGTGAACCATCTGCTTGG + Intergenic
1157452491 18:47799255-47799277 CCCCAGCTGGACCCTCTGCTTGG - Intergenic
1158318218 18:56235572-56235594 CTCCAGAAGGAACAGGGGCTTGG - Intergenic
1159034329 18:63262582-63262604 CTCCAGCCTGACCATGAGCTGGG - Intronic
1160412235 18:78683018-78683040 CGCCAGATGCCCCATGTCCTTGG - Intergenic
1160488957 18:79320657-79320679 CTGCATATGGACCATCTGGTTGG + Intronic
1161226609 19:3149887-3149909 CTGCAGAGGGCACATGTGCTCGG - Intronic
1161291945 19:3498819-3498841 CTCCAGTGGGTCCAGGTGCTGGG - Intronic
1164125471 19:22311606-22311628 CTCCAAATAGACCATATGATAGG - Intronic
1164156589 19:22601192-22601214 CTGCAGCTGGTCCATGAGCTGGG - Intergenic
1166648269 19:44549127-44549149 CTCCAGAGGGGCCAAGTTCTGGG + Intergenic
1166696837 19:44856690-44856712 CTCCAGATTCCCCAGGTGCTGGG - Intronic
1168104295 19:54157132-54157154 AACCAGTTGGACCAGGTGCTGGG + Intronic
925013177 2:501424-501446 CTGGAGATGGACAAAGTGCTGGG + Intergenic
925880223 2:8345990-8346012 CTGCAGTTGGAGGATGTGCTCGG - Intergenic
927469346 2:23360884-23360906 CTCCTGCTTGACCACGTGCTGGG - Intergenic
927521724 2:23703135-23703157 GTCAAGATGGACCTTGTGCGGGG - Intronic
932898262 2:75666446-75666468 CTCCATATAGATCATATGCTAGG - Intronic
937822918 2:126331894-126331916 CTTCATATAGACCATATGCTCGG + Intergenic
940282906 2:152005872-152005894 CTCCAAATAGCCCATGTACTTGG - Intronic
942988402 2:182169512-182169534 CTCAATAAGGACCATCTGCTAGG + Intronic
944643174 2:201748940-201748962 CTCCAGAGGGAGCATGTCTTGGG + Intronic
945462366 2:210124233-210124255 TCCCAGATGGACCATATGTTAGG + Intronic
946036707 2:216748562-216748584 CCCAAGATGGACCATGTGATAGG + Intergenic
947154468 2:227147426-227147448 CTTCAGATTGACCAAGTCCTTGG - Exonic
1169244095 20:4011529-4011551 CTCCAGCAGGACCATCTCCTGGG + Intronic
1169385641 20:5147098-5147120 CTCCTGAGGGGTCATGTGCTTGG + Intronic
1171025374 20:21625229-21625251 CTCCAGATGGGCCATGTTTCTGG - Intergenic
1171434006 20:25105127-25105149 CTTCATATGGACAGTGTGCTGGG - Intergenic
1172435464 20:34926036-34926058 GTACAGATGGAGCATGGGCTGGG + Intronic
1173810758 20:45953759-45953781 CACCAAATGGACCAGGTGCCAGG + Exonic
1175743310 20:61435866-61435888 ATCCTGTTGGCCCATGTGCTGGG + Intronic
1178287742 21:31339275-31339297 CTCCAAATGGGCCATCTGCAGGG + Exonic
1179467542 21:41586842-41586864 CTCCAGATAAACCATATGGTAGG - Intergenic
1180625539 22:17191212-17191234 CTCCAGTAGTACCATGTGCGTGG - Intronic
1180988107 22:19917472-19917494 CTCCTCATGCACCATTTGCTTGG - Intronic
1181133276 22:20746949-20746971 CTCCAAATGGAGCATGGGATGGG - Intronic
1181732112 22:24855018-24855040 CTCCTGATGGACCCTGTGGACGG + Exonic
1183589314 22:38770586-38770608 CTCCACAGGGTCCCTGTGCTGGG + Intronic
1183942679 22:41304838-41304860 CTGCAGATTGACCTTGGGCTGGG - Intronic
1184019870 22:41813745-41813767 CTGCAGATGGCCCAGGAGCTGGG + Exonic
1184050482 22:42000109-42000131 CTCAAGCTGGATGATGTGCTTGG + Intronic
1184654143 22:45932678-45932700 GTCCACATGGACCAGGCGCTGGG - Intronic
1185041778 22:48507890-48507912 CTGCAGATGGGCCTCGTGCTGGG - Intronic
949145819 3:698782-698804 CTCCTGATAGACCATATGATAGG - Intergenic
950588114 3:13911420-13911442 CTCAAGATAGACCATATGATGGG + Intergenic
952287572 3:31982863-31982885 CTCCACATGGACCTTAGGCTTGG + Intronic
954111973 3:48438939-48438961 TTCAAGAAGGTCCATGTGCTTGG - Intronic
959666258 3:108925537-108925559 CTCAAGATAGACCATATGGTAGG - Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
964397645 3:156263536-156263558 TCCAAGATGGACCATATGCTAGG - Intronic
966909205 3:184549209-184549231 CTACAGCTAGACCATGTTCTTGG + Intronic
968931458 4:3581683-3581705 CACCAGAGGGACCATGGGCCTGG - Intronic
969964371 4:10978732-10978754 CTGCAGATGGAGCATGTGTCTGG - Intergenic
971405381 4:26317821-26317843 CTGCAGATGGAGCATGTTTTAGG + Intronic
971872232 4:32257455-32257477 CTCCAGGTTGACCATCAGCTTGG - Intergenic
975109457 4:70607624-70607646 CTCCAGGGGCACCCTGTGCTTGG - Intergenic
975369233 4:73565464-73565486 CTCAAGACAGACCATGTGTTAGG - Intergenic
975720073 4:77240726-77240748 CTTCAGATGGAGCCTGGGCTGGG + Intronic
977362676 4:96026106-96026128 CTCCAGAGGGACCTGGTTCTAGG - Intergenic
977399432 4:96512948-96512970 CTTAAGATAGACCATATGCTAGG + Intergenic
984025478 4:174538604-174538626 CTGCAGAGGAACCATGTGCCTGG - Intergenic
990080787 5:51911325-51911347 TTCCAGATGGCCCATGTGTCTGG - Intergenic
990247080 5:53873888-53873910 GTTCAGAAGGGCCATGTGCTTGG - Intergenic
994379685 5:99056704-99056726 CTCCAGCTGGACCCTGTTTTAGG + Intergenic
996458182 5:123709102-123709124 CCCCAAATAGACCATATGCTGGG + Intergenic
996535248 5:124570752-124570774 CCCCAGCTGGCCCACGTGCTGGG - Intergenic
996875155 5:128232849-128232871 TTCAAGATAGACCATGTGATAGG - Intergenic
1001714826 5:173806791-173806813 CTGAAGATCTACCATGTGCTTGG - Intergenic
1002013065 5:176299853-176299875 CTCCAGATAGACCACATGTTGGG + Intronic
1002423982 5:179165146-179165168 CTCCAGCGGGACCACCTGCTGGG + Intronic
1002472191 5:179442148-179442170 CTCCACATGAACTATGTACTAGG + Intergenic
1003833076 6:10036198-10036220 CTGCAGATGGACCATGAGGGAGG + Intronic
1005423182 6:25673753-25673775 CTCCAGATGGCCCCTGTGTTAGG + Intronic
1005947328 6:30603939-30603961 CTCCTGAGGGAACATGAGCTGGG - Intronic
1008882738 6:56397539-56397561 CTCAAGATAGACCATATGATAGG + Intergenic
1009459394 6:63894143-63894165 CTCCAAATGCACCCTGTGCCAGG - Intronic
1010281165 6:74025144-74025166 TCCAAGATTGACCATGTGCTTGG - Intergenic
1010473348 6:76256840-76256862 CCCAAGATTGACCATATGCTTGG - Intergenic
1012303177 6:97615654-97615676 CTCAAGATAGACCATGTGTCAGG - Intergenic
1016190362 6:141257966-141257988 CACAAGGTAGACCATGTGCTTGG + Intergenic
1017212317 6:151870698-151870720 CTTCCCATGGACCAGGTGCTGGG - Intronic
1021465692 7:20940760-20940782 TTCAGGATAGACCATGTGCTAGG + Intergenic
1022045123 7:26616717-26616739 CTCCAGATGGAGCGAGTGGTTGG + Intergenic
1022480150 7:30738174-30738196 TTCAACATGTACCATGTGCTAGG + Intronic
1023224362 7:37953257-37953279 CTCCACATGGCCCATGAGATAGG - Intronic
1027813419 7:82936146-82936168 CTCTAGATAGACCATATGTTAGG + Intronic
1028641783 7:93050399-93050421 ATCAAGATAGACCATATGCTGGG + Intergenic
1030197157 7:106863728-106863750 CCTCAGAGGGACCATGAGCTTGG - Intergenic
1030752795 7:113251253-113251275 CTCAGGATGGACCATATGTTAGG + Intergenic
1030831569 7:114229475-114229497 CTTCAGATAGATCATGTGTTAGG + Intronic
1033877586 7:145842043-145842065 CCCCAGATGTACCAGGGGCTGGG - Intergenic
1035652886 8:1282063-1282085 GTCCGGATGGTTCATGTGCTGGG - Intergenic
1035652964 8:1282449-1282471 GTCCAGATGGTTCATGTGCTGGG - Intergenic
1035652985 8:1282564-1282586 GTCCAGATGGTTCATGTGCTGGG - Intergenic
1035653026 8:1282794-1282816 GTCCAGATGGTTCACGTGCTGGG - Intergenic
1035653070 8:1283025-1283047 GTCCAGATGGTTCACGTGCTGGG - Intergenic
1035653090 8:1283140-1283162 GTCCAGATGGTTCACGTGCTGGG - Intergenic
1038480802 8:27900722-27900744 CTGCAAATGGACCATCTACTAGG + Intronic
1041112872 8:54503206-54503228 ATCCAGATGGACCATGTCACTGG + Intergenic
1041783025 8:61598721-61598743 CTCCAGGTAGACCATATGTTAGG + Intronic
1042391469 8:68240625-68240647 CTCCAAATGGATCATGGGCTGGG + Intergenic
1044811432 8:96067415-96067437 AGCAAGATGGACCATGTTCTAGG - Intergenic
1045003778 8:97900293-97900315 GGCCAGATGGACCAAGAGCTGGG + Intronic
1046366229 8:113236183-113236205 CTGCAGTTGGAACATGTGCTCGG - Intronic
1046924185 8:119768574-119768596 CCCCAAATTGACCATATGCTTGG - Intronic
1048022587 8:130554251-130554273 CTCCAGATAGACCATTTGTTGGG - Intergenic
1048175402 8:132147950-132147972 CTCAGGATAGACCATGTGTTAGG - Intronic
1048649247 8:136455911-136455933 CACCACCTGGACCATGGGCTGGG + Intergenic
1049318429 8:141982250-141982272 TTGAAGATGGACCTTGTGCTAGG + Intergenic
1054458672 9:65450246-65450268 CACCAGAGGGACCATGGGCCTGG + Intergenic
1056612080 9:88132047-88132069 CTCCAGATGGGACAGGGGCTGGG + Intergenic
1058695996 9:107559441-107559463 CTTCACATGGATCTTGTGCTAGG - Intergenic
1059091964 9:111369085-111369107 CTCCAGCTGGAATATCTGCTGGG - Exonic
1060015872 9:120085911-120085933 CTCCAGCTGGTCCCTCTGCTTGG + Intergenic
1061179697 9:129017407-129017429 CCCCAGATAGACCATATACTAGG + Intronic
1061590828 9:131596548-131596570 CTCCAGACTCACCTTGTGCTTGG + Intronic
1062404341 9:136387786-136387808 CTACCGATGGACCAAGAGCTTGG - Exonic
1186182362 X:6985702-6985724 CTCCAGATGGGCCGTGTGGAAGG - Intergenic
1187361884 X:18636037-18636059 CTCCTGATTGAACATGTACTCGG - Intronic
1191077080 X:56466481-56466503 TTCAAGATAGACCATGTGATAGG - Intergenic
1192028773 X:67486500-67486522 ATCAAGATAGACCATGTTCTAGG + Intergenic
1196962769 X:121021850-121021872 TTACTGATGGACCATGTACTTGG - Intergenic
1197010008 X:121549206-121549228 TTCAAGATAGACCATGTGATAGG + Intergenic
1197345333 X:125321780-125321802 CTCCAGGGGGATCATGTTCTGGG - Intergenic
1197345345 X:125321843-125321865 CTCCAGGGGGATCATGTTCTGGG - Intergenic
1197345397 X:125322089-125322111 CTCCAGGGGGACCATGTTCTGGG - Intergenic
1197345464 X:125322398-125322420 CTCCAGGGGGACCATGTTCTGGG - Intergenic
1199553766 X:149083871-149083893 TTCAAGATAGACCATGTGATAGG + Intergenic
1200839845 Y:7770247-7770269 TTCCAAATTGACCATATGCTTGG - Intergenic
1201385187 Y:13432655-13432677 TTCCAGGTGGACCACGTGGTGGG - Intronic