ID: 1062794670

View in Genome Browser
Species Human (GRCh38)
Location 10:335558-335580
Sequence CCTAGAATCTTCCCAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062794670_1062794673 10 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
Right 1062794673 10:335591-335613 GTCCAATCAGTCCCCTAACTTGG No data
1062794670_1062794676 12 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
Right 1062794676 10:335593-335615 CCAATCAGTCCCCTAACTTGGGG No data
1062794670_1062794678 17 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
Right 1062794678 10:335598-335620 CAGTCCCCTAACTTGGGGGCTGG No data
1062794670_1062794674 11 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
Right 1062794674 10:335592-335614 TCCAATCAGTCCCCTAACTTGGG No data
1062794670_1062794682 30 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
Right 1062794682 10:335611-335633 TGGGGGCTGGTGCTTCCACATGG No data
1062794670_1062794677 13 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
Right 1062794677 10:335594-335616 CAATCAGTCCCCTAACTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062794670 Original CRISPR CCTAGAATCTTCCCAAAGCC TGG (reversed) Intronic