ID: 1062794670

View in Genome Browser
Species Human (GRCh38)
Location 10:335558-335580
Sequence CCTAGAATCTTCCCAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062794670_1062794677 13 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1062794677 10:335594-335616 CAATCAGTCCCCTAACTTGGGGG No data
1062794670_1062794678 17 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1062794678 10:335598-335620 CAGTCCCCTAACTTGGGGGCTGG No data
1062794670_1062794682 30 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1062794682 10:335611-335633 TGGGGGCTGGTGCTTCCACATGG No data
1062794670_1062794676 12 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1062794676 10:335593-335615 CCAATCAGTCCCCTAACTTGGGG No data
1062794670_1062794673 10 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1062794673 10:335591-335613 GTCCAATCAGTCCCCTAACTTGG No data
1062794670_1062794674 11 Left 1062794670 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1062794674 10:335592-335614 TCCAATCAGTCCCCTAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062794670 Original CRISPR CCTAGAATCTTCCCAAAGCC TGG (reversed) Intronic
902295560 1:15464445-15464467 CCTAGAATCTTCCAAACCTCTGG - Intronic
902298452 1:15484346-15484368 CCTAGAATCTTCCAAACCTCTGG - Intronic
902310100 1:15575592-15575614 ACTAGAATCTCCCCAAGGGCAGG - Intronic
902824776 1:18965525-18965547 CCTGGAATCTTCCCTCGGCCAGG - Intergenic
903449319 1:23442254-23442276 CCTAGTATCTGCTCAAAGCCGGG - Exonic
904277758 1:29395344-29395366 CCTAGCACCTTCCCACTGCCTGG + Intergenic
905010586 1:34744412-34744434 CCTAAAATATTCACAAAGCCAGG - Intronic
908558735 1:65284077-65284099 CCTGCCATCTTCCCAATGCCTGG + Intronic
909646333 1:77921331-77921353 GCTACAACCTTCCCAAACCCAGG - Intronic
909709703 1:78633520-78633542 CCTTGCATAGTCCCAAAGCCTGG - Intronic
910576554 1:88771742-88771764 CCAAGAATCATCCCAAAAGCAGG + Exonic
910732043 1:90408270-90408292 CCTACCATCTTGCCAAATCCTGG - Intergenic
912933979 1:113986868-113986890 GAAAGAATCTCCCCAAAGCCTGG + Intergenic
913972980 1:143430188-143430210 CCTAGTACCAGCCCAAAGCCAGG - Intergenic
914067364 1:144255795-144255817 CCTAGTACCAGCCCAAAGCCAGG - Intergenic
914111789 1:144710559-144710581 CCTAGTACCAGCCCAAAGCCAGG + Intergenic
915001473 1:152597712-152597734 CCTTGAAACTTCCCCAGGCCAGG - Intronic
917804741 1:178603643-178603665 CATAGACTATTCACAAAGCCAGG + Intergenic
920363807 1:205437490-205437512 GCTAGAATCTTCCCCTAGCCAGG - Intronic
920654050 1:207861918-207861940 CCTAGAATGTTCAAGAAGCCAGG - Intergenic
921937714 1:220810333-220810355 CGTTGAGTCTTCCCACAGCCTGG + Intronic
1062794670 10:335558-335580 CCTAGAATCTTCCCAAAGCCTGG - Intronic
1064322733 10:14320726-14320748 CCAAAATTCCTCCCAAAGCCTGG + Intronic
1064773491 10:18749712-18749734 CTCAGAATCTTCCCTAAGTCAGG + Intergenic
1066512826 10:36120658-36120680 CCCTGAATCCTCCCAGAGCCTGG - Intergenic
1067341974 10:45412905-45412927 CCTAGAGTCTCCCGATAGCCTGG - Intronic
1070779409 10:79128806-79128828 ACTGGAATGATCCCAAAGCCCGG - Intronic
1072420722 10:95289325-95289347 CCCAGAATCGTCCCCGAGCCTGG - Intronic
1073448865 10:103597571-103597593 CCTATCATCTTCCCAAAGAAGGG + Exonic
1075153899 10:119958366-119958388 CCTAGTATCCTTCCAAATCCTGG - Intergenic
1075340416 10:121643317-121643339 CCAAGAATCTCCCCTGAGCCAGG - Intergenic
1075573672 10:123563093-123563115 CTAAGACTCTTCCCAGAGCCAGG - Intergenic
1076202201 10:128567715-128567737 CCTGGAACCCTCCCAAATCCAGG - Intergenic
1076650837 10:131986154-131986176 CACAGAATCCTCCCAAATCCTGG - Intergenic
1083336675 11:61925923-61925945 CATTTAATCTTCCCAAAGCAGGG - Intergenic
1083491844 11:63019500-63019522 CCCAGAATCTGCCCAAAGTAAGG - Intergenic
1084177315 11:67429653-67429675 CCTGCTGTCTTCCCAAAGCCTGG - Intronic
1085290025 11:75391495-75391517 CCTTGAATAGTCCCAAAGGCAGG + Intergenic
1085634891 11:78151071-78151093 CCTATATTCTCCCCAAAGCAGGG + Intergenic
1086406004 11:86499429-86499451 CCTAGAATGGATCCAAAGCCAGG - Intronic
1086464853 11:87042482-87042504 ACTAGAATTTTCCCCAAGGCAGG - Intronic
1090061454 11:123467569-123467591 GCCAGAATCTTCCTAATGCCAGG - Intergenic
1093804492 12:23415606-23415628 CCTTGAATCTTCCCAGAATCTGG - Intergenic
1094808605 12:34115328-34115350 CCTAGCACCATCCCAAAGCCAGG + Intergenic
1096525987 12:52210782-52210804 CCTGGAAGCTTCCCAAGGGCAGG + Intergenic
1098000720 12:65939173-65939195 GGGAGAATCTTCCCAAAGCAGGG - Intronic
1098552478 12:71778579-71778601 ACTACACTATTCCCAAAGCCTGG - Intronic
1099710997 12:86223976-86223998 CTGAGAATCTGCCCAAAACCTGG + Intronic
1100714973 12:97295905-97295927 CCTAAAATCTTCACTAAGGCAGG + Intergenic
1101014351 12:100484016-100484038 CTTAGATTCTGCCCAAAGGCTGG - Intronic
1102421031 12:112803007-112803029 CCCAGAAGCTGTCCAAAGCCTGG + Intronic
1102469194 12:113149999-113150021 ACTATGATCTGCCCAAAGCCAGG - Intronic
1107298952 13:38945801-38945823 CCTAGAATGTTCCAGAGGCCAGG - Intergenic
1107632918 13:42360973-42360995 CCTAGAAGTTTCCCAAAAACTGG - Intergenic
1110054033 13:70941898-70941920 CTTAGATACTTCCCATAGCCTGG - Intergenic
1114030725 14:18577685-18577707 CCTAGTACCAGCCCAAAGCCAGG - Intergenic
1115019968 14:28666958-28666980 CCTAGAAAGTTTCCAAAACCAGG - Intergenic
1120451422 14:84671993-84672015 TCTAGAATGTTCCCAACGCTAGG + Intergenic
1120844956 14:89117315-89117337 CCGATAATATCCCCAAAGCCCGG - Intergenic
1122303354 14:100744901-100744923 CCTAGAATTTTCCCTAAGCTGGG - Intergenic
1123055724 14:105568725-105568747 CCTAGAATCTGCCCAAGTCTGGG - Intergenic
1124231046 15:27946754-27946776 ACTAGAATCTTTCCCAAGGCAGG + Intronic
1128751928 15:70156083-70156105 CCTGGAAGCTCCCCAAGGCCTGG + Intergenic
1129167506 15:73787090-73787112 CGGAGCATCTCCCCAAAGCCTGG - Intergenic
1131687286 15:94782151-94782173 CCAAGAATTTTCCCAAAGTGGGG + Intergenic
1135995530 16:27244921-27244943 CCTAGAAAATTCACAAAGCATGG - Intronic
1138181105 16:54940502-54940524 ACTTGAATCCTCACAAAGCCAGG - Intergenic
1140619875 16:76716914-76716936 CCCAGTACCTTCCCAGAGCCAGG + Intergenic
1141781995 16:86168731-86168753 CCTAGAATTCACCCCAAGCCTGG - Intergenic
1142236561 16:88925211-88925233 CCTGGCACCTTCCCAAGGCCGGG - Intronic
1144329870 17:14213532-14213554 CCTGGAATCTCCCCACTGCCTGG + Intergenic
1147258108 17:39194148-39194170 CTTAGCATCTCACCAAAGCCTGG - Intronic
1148702892 17:49601123-49601145 CATAGAAAATTCCCAAAGACAGG - Intronic
1149337006 17:55645558-55645580 CCAAGCAGTTTCCCAAAGCCAGG - Intergenic
1152123800 17:78434493-78434515 CCTAATATCTTCCCAAATCCTGG + Intronic
1152592071 17:81218650-81218672 CCAAGCAGGTTCCCAAAGCCTGG - Intronic
1153045053 18:848292-848314 CCTAGAATATTCACAGAGGCAGG + Intergenic
1153453307 18:5253643-5253665 CCTAGAACCTTCCCTAACCTGGG - Intergenic
1155036140 18:22026501-22026523 GCTGGACGCTTCCCAAAGCCAGG - Intergenic
1157128201 18:44977668-44977690 CCCAGAATAATCCCATAGCCTGG + Intronic
1159944846 18:74436765-74436787 CCTAAAAGCTTCCCAAGCCCAGG + Intronic
1163274778 19:16276726-16276748 CTTAAAATCTTCCCAGAGCAGGG + Intergenic
1163658803 19:18564215-18564237 TCTAGAAGTTTCCCAGAGCCAGG - Intronic
1165274245 19:34734271-34734293 CCCAGAATCGTCCCGGAGCCTGG - Intronic
925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG + Intronic
927509596 2:23636088-23636110 CCTAGAAGCTTCCAGAACCCGGG + Intronic
931782015 2:65587045-65587067 CCCTGAAGCTTCCCAAAGGCAGG + Intergenic
932860738 2:75288750-75288772 CCTAGCATCTTACTAAAACCTGG + Intergenic
934177677 2:89591144-89591166 CCTAGTACCAGCCCAAAGCCAGG - Intergenic
934187074 2:89756640-89756662 CCTAGTACCAGCCCAAAGCCAGG - Intergenic
934287976 2:91665445-91665467 CCTAGTACCAGCCCAAAGCCAGG - Intergenic
934309561 2:91851285-91851307 CCTAGTACCAGCCCAAAGCCAGG + Intergenic
936293391 2:111246578-111246600 CCTAAAATGTTCCCAGAGTCAGG - Intergenic
938731442 2:134151048-134151070 CCTTGAATCTTTCCAAACCTGGG - Intronic
939106913 2:137959768-137959790 ACTAGAATCTTTCCAAAGGAGGG + Intergenic
943191120 2:184680841-184680863 CCTAGGAGCTCCCCCAAGCCAGG + Intronic
946073017 2:217050532-217050554 CCTAGATTCATCCAGAAGCCAGG + Intergenic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
948938935 2:241186692-241186714 CCTGGGCTCTTCCCAAGGCCTGG + Intergenic
1169064937 20:2689865-2689887 CCTAGAATGTTCCCAAACTAAGG + Intergenic
1169342559 20:4807620-4807642 CCTAGAAAATTCCCACAGTCGGG - Intronic
1172497071 20:35395108-35395130 CCTAGAAGCTCTCCAAACCCAGG + Intronic
1173287417 20:41685912-41685934 CAAAGAAACTGCCCAAAGCCAGG + Intergenic
1174304509 20:49605562-49605584 CCTAGAACTTTCCCAAAGTGGGG - Intergenic
1174395422 20:50244076-50244098 CCCTGAACCTTCCCAAGGCCAGG + Intergenic
1174965307 20:55207555-55207577 CTGAGAATTTTCCAAAAGCCAGG - Intergenic
1175592236 20:60202288-60202310 CCTAGAGTCTCTCCAAAGCAAGG + Intergenic
1175699347 20:61125716-61125738 GCTAGAATCTTCTCCAAGCCGGG + Intergenic
1180454839 22:15504741-15504763 CCTAGTACCAGCCCAAAGCCAGG - Intergenic
1180536655 22:16398422-16398444 CCTAGTACCAGCCCAAAGCCAGG + Intergenic
1181897254 22:26121441-26121463 CCTAGCTCCTGCCCAAAGCCAGG + Intergenic
1183778078 22:39980885-39980907 CCTAGCAACTTCCCATAACCAGG - Intergenic
1183883476 22:40856752-40856774 CCTAGAATCTTCTAGAAGCGTGG + Exonic
949513201 3:4784338-4784360 CCTAGAATCTTCCCACGTCTGGG - Intronic
951067545 3:18284728-18284750 ACTATAATTTTCCCAAAGCATGG + Intronic
952889024 3:38029085-38029107 CCCAGAGGCTCCCCAAAGCCTGG - Intronic
955523627 3:59799062-59799084 TCTAGAATCTTCCAAAGGGCAGG - Intronic
956930556 3:74038361-74038383 TCTAGAATCATCCCTCAGCCAGG - Intergenic
960302113 3:116015885-116015907 CGTAGAATCTTCCCCTATCCAGG + Intronic
960544190 3:118893737-118893759 ATTAGAATATTCCCAAAGCAAGG - Intergenic
962583247 3:136817580-136817602 CCAAGAATGTTCCCAAAGAGGGG - Intergenic
970706064 4:18804358-18804380 CCTTGAAACTTCTCAAGGCCAGG + Intergenic
975399723 4:73920699-73920721 CCTACAATTTTCCAAAAGCTTGG - Intergenic
976920596 4:90437574-90437596 TCTGGAACCTTCCCAAAACCAGG - Intronic
982338103 4:154262311-154262333 CCTTGAATCATCCCACAGACTGG - Intronic
983092657 4:163523125-163523147 CCTATAATCTTCCCAGAGCATGG + Intergenic
983389949 4:167117548-167117570 GCTAGAACTTGCCCAAAGCCAGG + Intronic
986461449 5:7976639-7976661 AATAGACTCTTCACAAAGCCTGG + Intergenic
988081091 5:26416334-26416356 TGTAGGATCTTCCCCAAGCCAGG - Intergenic
990548936 5:56852950-56852972 CATATAATCTTCCATAAGCCAGG - Intronic
991110933 5:62898450-62898472 CCTAGAGTCTTGGGAAAGCCTGG - Intergenic
992769450 5:80034020-80034042 CCTAGATTCCTCTCAAACCCAGG + Intronic
994679707 5:102870706-102870728 TCTCTAATCTTCCCAAAGGCTGG - Intronic
995015300 5:107302771-107302793 CCTGTAGCCTTCCCAAAGCCAGG + Intergenic
995080048 5:108040273-108040295 CCCAGATCCTTCCCAAAGCAAGG - Intronic
995680881 5:114718158-114718180 ACTAGACACTTCCCAAAGCATGG + Intergenic
999108702 5:149095991-149096013 CCTAGCACCTGCCCAGAGCCTGG + Intergenic
1000789301 5:165585818-165585840 CCTAGAGTCTTCAGGAAGCCTGG + Intergenic
1003845186 6:10166503-10166525 CCTATGTTCTTCCTAAAGCCAGG + Intronic
1004280558 6:14276231-14276253 CCTAGAAGGTTCCCCAAACCAGG + Intergenic
1004887696 6:20067593-20067615 CTTAGAAGCCTCTCAAAGCCAGG + Intergenic
1009906236 6:69873008-69873030 CATAGAATAATCCCAAAGCCTGG - Intronic
1013727283 6:113114454-113114476 CCGAGATTCTTCCCTTAGCCTGG - Intergenic
1015122684 6:129717352-129717374 TCTAGAATCTTCACAAGGCCCGG - Intergenic
1017916591 6:158836239-158836261 CCTAGGATCTTCCCTGAGTCTGG - Intergenic
1019490113 7:1308621-1308643 CCGAGACTCTTCCCAAGGGCGGG - Intergenic
1019536481 7:1532015-1532037 CTCAGGATCTTCCCAAGGCCAGG - Intronic
1020832476 7:13109619-13109641 CCTAGGAGCTTCCCAAACCAGGG - Intergenic
1022527817 7:31049728-31049750 CCTCAGGTCTTCCCAAAGCCAGG + Intergenic
1023843711 7:44109833-44109855 CCTGGAATCGACTCAAAGCCAGG - Intronic
1029604712 7:101591415-101591437 CCTAGAAACTCCTCGAAGCCAGG + Intergenic
1032700434 7:134374120-134374142 CCTTGAATGCTCCCAAAGGCAGG + Intergenic
1037377880 8:18251330-18251352 CCTTAAGTCTTCCCTAAGCCAGG + Intergenic
1038039795 8:23714969-23714991 CCTACAATATCCCCAAAGCCTGG + Intergenic
1038446345 8:27606763-27606785 CCTAGAAGCTTCCCAACTCCTGG + Intronic
1038692074 8:29773072-29773094 CCTGAAATCCTCCCAAAGTCTGG - Intergenic
1039084169 8:33763369-33763391 CCTAAAATCTTCCTAGAGGCAGG + Intergenic
1039328469 8:36510769-36510791 CCTACAATCTTACCAAAGTGTGG + Intergenic
1040817605 8:51525680-51525702 GCCAGAATCTTCCCTGAGCCAGG - Intronic
1041546928 8:59056128-59056150 CCAAGAATCATACCGAAGCCAGG + Intronic
1042183554 8:66114723-66114745 CCTCGGATCTGCCCAGAGCCAGG - Intergenic
1045660808 8:104435852-104435874 CCTAAAATCTACCAAAACCCCGG - Intronic
1046959361 8:120093999-120094021 CCAAGAATCTTCCTGAAGCTTGG - Intronic
1047653925 8:126954535-126954557 CTTTGAATTTTACCAAAGCCAGG - Intergenic
1047718957 8:127620870-127620892 CCTGGAATCCACCCACAGCCTGG + Intergenic
1048322063 8:133407773-133407795 CCTAGAATCTTCTAGAAGCGTGG - Intergenic
1053066940 9:35075581-35075603 TCTGGCATCTTCCCACAGCCGGG + Exonic
1056506291 9:87261206-87261228 CCAAGGACCTTCCCCAAGCCAGG - Intergenic
1057262706 9:93594353-93594375 CCTGGAATGTTCCCAAAGCAGGG - Intronic
1060492320 9:124093925-124093947 CCAAGGAGCTTCTCAAAGCCTGG + Intergenic
1062530113 9:136995990-136996012 CCTGGAATCTTGTCAGAGCCTGG + Intronic
1062678928 9:137765880-137765902 CCTCGAAGCTTCCAACAGCCTGG - Intronic
1187795732 X:23001963-23001985 CCTGGAATCTTCCAGTAGCCTGG - Exonic
1188512467 X:30950957-30950979 CATAGAATCTTCCCATCTCCTGG + Intronic
1189088529 X:38052704-38052726 ACTAGCATCTTCCCAAAGGCAGG - Intronic
1189137015 X:38561080-38561102 CCCATAAACTTCCCATAGCCAGG + Intronic
1190367811 X:49713548-49713570 ACAAGAATCTTGCCAAAGGCAGG - Intergenic
1192052401 X:67736757-67736779 CTTAGAATCTTACCAGACCCTGG + Intergenic
1195157082 X:102134422-102134444 CCTAGCATCCTCTCACAGCCAGG + Intergenic
1197052503 X:122077000-122077022 CTCAGAATCTTCCCAAGGACTGG - Intergenic
1197133253 X:123030550-123030572 GCTACAATCTTCCCAGAGCCAGG - Intergenic
1198059108 X:133025930-133025952 CCTCAAAGCTTTCCAAAGCCAGG - Exonic
1199878172 X:151951575-151951597 CCTGCACTCTTCCCAAAGGCAGG + Intergenic