ID: 1062794671

View in Genome Browser
Species Human (GRCh38)
Location 10:335558-335580
Sequence CCAGGCTTTGGGAAGATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062794667_1062794671 -6 Left 1062794667 10:335541-335563 CCGTGACTCTCACGACACCAGGC No data
Right 1062794671 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
1062794662_1062794671 24 Left 1062794662 10:335511-335533 CCGCTGCCCAGAGCGAGTTTCTG No data
Right 1062794671 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
1062794664_1062794671 18 Left 1062794664 10:335517-335539 CCCAGAGCGAGTTTCTGGATGTT No data
Right 1062794671 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
1062794661_1062794671 25 Left 1062794661 10:335510-335532 CCCGCTGCCCAGAGCGAGTTTCT No data
Right 1062794671 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data
1062794665_1062794671 17 Left 1062794665 10:335518-335540 CCAGAGCGAGTTTCTGGATGTTT No data
Right 1062794671 10:335558-335580 CCAGGCTTTGGGAAGATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062794671 Original CRISPR CCAGGCTTTGGGAAGATTCT AGG Intronic